Something changed between CARD 1.1.7 and 1.1.8. ariba getref --version 1.1.7 works.

shutil.rmtree calls fail when the root_dir is an NFS volume. This due to how NFS handles files that are opened and then deleted while still open by silly renaming them.

Use ariba run --noclean ... or output to a non-NFS directory (and then move if needed) to circumvent issue.

Fix issue by explicitly closing files. I'll send through a pull request if I have time.

Hi,

I recently installed ariba on Red Hat linux using pip. It installs without error, however when I run the command "python ariba test out" in the directory where ariba is installed I get the error " can't find 'main' module in 'ariba' ". Any ideas on why I would be getting this error?

Hi!

I am able to install ariba without any issues, but, I do get the following error when I try to run it:

(ariba)[karinlag@abel ariba]$ ariba --help
Traceback (most recent call last):
  File "/work/projects/nn9305k/bin/virtenv/ariba/bin/ariba", line 3, in <module>
    import ariba
  File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/ariba/__init__.py", line 55, in <module>
    from ariba import *
  File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/ariba/assembly.py", line 6, in <module>
    import fermilite_ariba
ImportError: /cluster/software/VERSIONS/intel-2017.1/advisor_2017.1.1.486553/lib64/libstdc++.so.6: version `GLIBCXX_3.4.21' not found (required by /work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/fermilite_ariba.cpython-35m-x86_64-linux-gnu.so)
(ariba)[karinlag@abel ariba]$

I believe this is Heng Li's fermi-lite, is it not? If so, I will take the issue there. I have a sneaking suspicion this is down to which intel something-or-other that I have loaded, but no clue of how to figure out what I need...

Currently when SNPs are in coding region in same amino acid it is report like G;G.

I think AAT=>AGG makes more sense to biologists and gives context.

For my samples I see the following in the log:
__________________________ Assembling each cluster ___________________________
Will run 1 cluster(s) in parallel
Constructing cluster APH_9__Ia (1 of 9)
Constructing cluster Chlamydophila_psittaci_16S (2 of 9)
Constructing cluster Helicobacter_pylori_16S (3 of 9)
Constructing cluster Mycobacterium_abscessus_16S+ (4 of 9)
Constructing cluster Neisseria_- (5 of 9)
Constructing cluster OXA_29 (6 of 9)
Constructing cluster Pasteurella_multocida_16S (7 of 9)
Not constructing cluster Propionibacterium_acnes_16S because it only has 2 reads (8 of 9)
Constructing cluster rrsB+ (9 of 9)

I notice these clusters are listed in debug.report.tsv for all of my samples. In some of my samples the final report.tsv file is empty. In others only one of the clusters listed in the debug file is described in the report.tsv file. Can I tweak some of the nucmer or assembly options so that all the clusters are described in the report.tsv file?

I am working on a CentOS 6.8 cluster where I don't have root access.
This system uses the modules system to load software:
http://modules.sourceforge.net/

To make things a bit neater and easier on myself, I use virtualenvs to install python stuff. This system has python 2.6 running natively and other pythons are loaded via the module system. Thus, I load python3 before creating a new virtualenv for ariba. Thus my python version is now

(ariba)[karinlag@abel nn9305k]$ python
Python 3.5.0 (default, Oct 9 2015, 14:50:11)

my gcc version is

(ariba)[karinlag@abel nn9305k]$ gcc --version
gcc (GCC) 4.4.7 20120313 (Red Hat 4.4.7-17)

I ensure that I have all the required modules loaded (bowtie2, mummer, cd-hit) before pip3 installing ariba (not sure that actually makes a difference for install, but better safe than sorry).

I am giving you output until the first error (it keeps running after that, but that also just gives errors, I can get you those if you want too).

(ariba)[karinlag@abel virtenv]$ pip3 install ariba
Collecting ariba
Using cached ariba-2.7.2.tar.gz
Collecting BeautifulSoup4>=4.1.0 (from ariba)
Using cached beautifulsoup4-4.5.3-py3-none-any.whl
Collecting dendropy>=4.2.0 (from ariba)
Collecting pyfastaq>=3.12.0 (from ariba)
Collecting pysam>=0.9.1 (from ariba)
Using cached pysam-0.10.0.tar.gz
Collecting pymummer>=0.10.2 (from ariba)
Requirement already satisfied (use --upgrade to upgrade): setuptools in ./ariba/lib/python3.5/site-packages (from dendropy>=4.2.0->ariba)
Building wheels for collected packages: ariba, pysam
Running setup.py bdist_wheel for ariba
Complete output from command /work/projects/nn9305k/bin/virtenv/ariba/bin/python3.5 -c "import setuptools;file='/tmp/pip-build-63898kee/ariba/setup.py';exec(compile(open(file).read().replace('\r\n', '\n'), file, 'exec'))" bdist_wheel -d /tmp/tmpthur2d5opip-wheel-:
running bdist_wheel
running build
running build_py
creating build
creating build/lib.linux-x86_64-3.5
creating build/lib.linux-x86_64-3.5/ariba
copying ariba/report.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/common.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/samtools_variants.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/ref_preparer.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/mlst_profile.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/external_progs.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/scaffold_graph.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/aln_to_metadata.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/assembly.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/clusters.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/ref_seq_chooser.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/faidx.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/link.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/pubmlst_ref_preparer.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/megares_data_finder.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/reference_data.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/report_filter.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/summary_cluster.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/sequence_variant.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/summary.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/read_store.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/assembly_compare.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/cdhit.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/refdata_query.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/summary_sample.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/mlst_reporter.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/vfdb_parser.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/sequence_metadata.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/card_record.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/versions.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/cluster.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/assembly_variants.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/flag.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/megares_zip_parser.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/summary_cluster_variant.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/histogram.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/read_filter.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/pubmlst_getter.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/bam_parse.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/ref_genes_getter.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/init.py -> build/lib.linux-x86_64-3.5/ariba
copying ariba/mapping.py -> build/lib.linux-x86_64-3.5/ariba
creating build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/getref.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/pubmlstget.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/pubmlstspecies.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/run.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/aln2meta.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/summary.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/prepareref.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/reportfilter.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/flag.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/refquery.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/test.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/version.py -> build/lib.linux-x86_64-3.5/ariba/tasks
copying ariba/tasks/init.py -> build/lib.linux-x86_64-3.5/ariba/tasks
creating build/lib.linux-x86_64-3.5/ariba/test_run_data
copying ariba/test_run_data/metadata.tsv -> build/lib.linux-x86_64-3.5/ariba/test_run_data
copying ariba/test_run_data/reads_1.fq -> build/lib.linux-x86_64-3.5/ariba/test_run_data
copying ariba/test_run_data/ref_fasta_to_make_reads_from.fa -> build/lib.linux-x86_64-3.5/ariba/test_run_data
copying ariba/test_run_data/reads_2.fq -> build/lib.linux-x86_64-3.5/ariba/test_run_data
copying ariba/test_run_data/ref_seqs.fa -> build/lib.linux-x86_64-3.5/ariba/test_run_data
running build_ext
building 'minimap_ariba' extension
creating build/temp.linux-x86_64-3.5
creating build/temp.linux-x86_64-3.5/third_party
creating build/temp.linux-x86_64-3.5/third_party/minimap-0.2
creating build/temp.linux-x86_64-3.5/ariba
creating build/temp.linux-x86_64-3.5/ariba/ext
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/bseq.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/bseq.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/index.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/index.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/kthread.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/kthread.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/map.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/map.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/misc.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/misc.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/sdust.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/sdust.o
third_party/minimap-0.2/sdust.c(20): warning #2959: function prototype is missing the argument types
KDQ_INIT(int)
^

icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/minimap-0.2/sketch.c -o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/sketch.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/minimap-0.2 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c ariba/ext/minimap_ariba.cpp -o build/temp.linux-x86_64-3.5/ariba/ext/minimap_ariba.o
icpc -shared -L/cluster/software/VERSIONS/intel-2016.0/compiler/lib/intel64 -L/cluster/software/VERSIONS/libffi-3.0.13/lib -L/usr/lib/x86_64-linux-gnu -ipo -O2 -xAVX -mavx -O2 -xAVX -mavx -O2 -xAVX -mavx build/temp.linux-x86_64-3.5/third_party/minimap-0.2/bseq.o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/index.o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/kthread.o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/map.o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/misc.o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/sdust.o build/temp.linux-x86_64-3.5/third_party/minimap-0.2/sketch.o build/temp.linux-x86_64-3.5/ariba/ext/minimap_ariba.o -L/cluster/software/VERSIONS/python3-3.5.0/lib -lpython3.5m -o build/lib.linux-x86_64-3.5/minimap_ariba.cpython-35m-x86_64-linux-gnu.so -lz
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/bseq.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/index.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/kthread.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/map.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/misc.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/sdust.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/minimap-0.2/sketch.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/ariba/ext/minimap_ariba.o; was the source file compiled with -ipo
building 'fermilite_ariba' extension
creating build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/bfc.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bfc.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/bseq.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bseq.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/bubble.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bubble.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/htab.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/htab.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/ksw.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/ksw.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/kthread.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/kthread.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/mag.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/mag.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/misc.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/misc.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/mrope.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/mrope.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/rld0.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rld0.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/rle.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rle.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/rope.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rope.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c third_party/fermi-lite-0.1/unitig.c -o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/unitig.o
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -Ithird_party/fermi-lite-0.1 -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c ariba/ext/fml-asm_ariba.cpp -o build/temp.linux-x86_64-3.5/ariba/ext/fml-asm_ariba.o
icpc -shared -L/cluster/software/VERSIONS/intel-2016.0/compiler/lib/intel64 -L/cluster/software/VERSIONS/libffi-3.0.13/lib -L/usr/lib/x86_64-linux-gnu -ipo -O2 -xAVX -mavx -O2 -xAVX -mavx -O2 -xAVX -mavx build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bfc.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bseq.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bubble.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/htab.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/ksw.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/kthread.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/mag.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/misc.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/mrope.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rld0.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rle.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rope.o build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/unitig.o build/temp.linux-x86_64-3.5/ariba/ext/fml-asm_ariba.o -L/cluster/software/VERSIONS/python3-3.5.0/lib -lpython3.5m -o build/lib.linux-x86_64-3.5/fermilite_ariba.cpython-35m-x86_64-linux-gnu.so -lz
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bfc.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bseq.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/bubble.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/htab.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/ksw.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/kthread.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/mag.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/misc.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/mrope.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rld0.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rle.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/rope.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/third_party/fermi-lite-0.1/unitig.o; was the source file compiled with -ipo
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/ariba/ext/fml-asm_ariba.o; was the source file compiled with -ipo
building 'vcfcall_ariba' extension
icc -DNDEBUG -g -O3 -Wall -Wstrict-prototypes -O2 -xAVX -mavx -fPIC -I/cluster/software/VERSIONS/python3-3.5.0/include/python3.5m -c ariba/ext/vcfcall_ariba.cpp -o build/temp.linux-x86_64-3.5/ariba/ext/vcfcall_ariba.o
icpc -shared -L/cluster/software/VERSIONS/intel-2016.0/compiler/lib/intel64 -L/cluster/software/VERSIONS/libffi-3.0.13/lib -L/usr/lib/x86_64-linux-gnu -ipo -O2 -xAVX -mavx -O2 -xAVX -mavx -O2 -xAVX -mavx build/temp.linux-x86_64-3.5/ariba/ext/vcfcall_ariba.o -L/cluster/software/VERSIONS/python3-3.5.0/lib -lpython3.5m -o build/lib.linux-x86_64-3.5/vcfcall_ariba.cpython-35m-x86_64-linux-gnu.so
ipo: warning #11003: no IR in object file build/temp.linux-x86_64-3.5/ariba/ext/vcfcall_ariba.o; was the source file compiled with -ipo
running build_scripts
creating build/scripts-3.5
copying and adjusting scripts/ariba -> build/scripts-3.5
changing mode of build/scripts-3.5/ariba from 664 to 775
installing to build/bdist.linux-x86_64/wheel
running install
running install_lib
creating build/bdist.linux-x86_64
creating build/bdist.linux-x86_64/wheel
copying build/lib.linux-x86_64-3.5/fermilite_ariba.cpython-35m-x86_64-linux-gnu.so -> build/bdist.linux-x86_64/wheel
creating build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/report.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/common.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/samtools_variants.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/ref_preparer.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/mlst_profile.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/external_progs.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/scaffold_graph.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/aln_to_metadata.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/assembly.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/clusters.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/ref_seq_chooser.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/faidx.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/link.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/pubmlst_ref_preparer.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/megares_data_finder.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/reference_data.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/report_filter.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/summary_cluster.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/sequence_variant.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/summary.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/read_store.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/assembly_compare.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/cdhit.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/refdata_query.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/summary_sample.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/mlst_reporter.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/vfdb_parser.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/sequence_metadata.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/card_record.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/versions.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/cluster.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/assembly_variants.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/flag.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/megares_zip_parser.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/summary_cluster_variant.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/histogram.py -> build/bdist.linux-x86_64/wheel/ariba
creating build/bdist.linux-x86_64/wheel/ariba/test_run_data
copying build/lib.linux-x86_64-3.5/ariba/test_run_data/metadata.tsv -> build/bdist.linux-x86_64/wheel/ariba/test_run_data
copying build/lib.linux-x86_64-3.5/ariba/test_run_data/reads_1.fq -> build/bdist.linux-x86_64/wheel/ariba/test_run_data
copying build/lib.linux-x86_64-3.5/ariba/test_run_data/ref_fasta_to_make_reads_from.fa -> build/bdist.linux-x86_64/wheel/ariba/test_run_data
copying build/lib.linux-x86_64-3.5/ariba/test_run_data/reads_2.fq -> build/bdist.linux-x86_64/wheel/ariba/test_run_data
copying build/lib.linux-x86_64-3.5/ariba/test_run_data/ref_seqs.fa -> build/bdist.linux-x86_64/wheel/ariba/test_run_data
copying build/lib.linux-x86_64-3.5/ariba/read_filter.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/pubmlst_getter.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/bam_parse.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/ref_genes_getter.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/init.py -> build/bdist.linux-x86_64/wheel/ariba
copying build/lib.linux-x86_64-3.5/ariba/mapping.py -> build/bdist.linux-x86_64/wheel/ariba
creating build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/getref.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/pubmlstget.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/pubmlstspecies.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/run.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/aln2meta.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/summary.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/prepareref.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/reportfilter.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/flag.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/refquery.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/test.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/version.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/ariba/tasks/init.py -> build/bdist.linux-x86_64/wheel/ariba/tasks
copying build/lib.linux-x86_64-3.5/vcfcall_ariba.cpython-35m-x86_64-linux-gnu.so -> build/bdist.linux-x86_64/wheel
copying build/lib.linux-x86_64-3.5/minimap_ariba.cpython-35m-x86_64-linux-gnu.so -> build/bdist.linux-x86_64/wheel
running install_egg_info
running egg_info
writing requirements to ariba.egg-info/requires.txt
writing ariba.egg-info/PKG-INFO
writing top-level names to ariba.egg-info/top_level.txt
writing dependency_links to ariba.egg-info/dependency_links.txt
warning: manifest_maker: standard file '-c' not found

reading manifest file 'ariba.egg-info/SOURCES.txt'
reading manifest template 'MANIFEST.in'
writing manifest file 'ariba.egg-info/SOURCES.txt'
Copying ariba.egg-info to build/bdist.linux-x86_64/wheel/ariba-2.7.2-py3.5.egg-info
running install_scripts
creating build/bdist.linux-x86_64/wheel/ariba-2.7.2.data
creating build/bdist.linux-x86_64/wheel/ariba-2.7.2.data/scripts
copying build/scripts-3.5/ariba -> build/bdist.linux-x86_64/wheel/ariba-2.7.2.data/scripts
changing mode of build/bdist.linux-x86_64/wheel/ariba-2.7.2.data/scripts/ariba to 775
Traceback (most recent call last):
File "", line 1, in
File "/tmp/pip-build-63898kee/ariba/setup.py", line 80, in
'License :: OSI Approved :: GNU General Public License v3 (GPLv3)',
File "/cluster/software/VERSIONS/python3-3.5.0/lib/python3.5/distutils/core.py", line 148, in setup
dist.run_commands()
File "/cluster/software/VERSIONS/python3-3.5.0/lib/python3.5/distutils/dist.py", line 955, in run_commands
self.run_command(cmd)
File "/cluster/software/VERSIONS/python3-3.5.0/lib/python3.5/distutils/dist.py", line 974, in run_command
cmd_obj.run()
File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/wheel/bdist_wheel.py", line 213, in run
archive_basename = self.get_archive_basename()
File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/wheel/bdist_wheel.py", line 161, in get_archive_basename
impl_tag, abi_tag, plat_tag = self.get_tag()
File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/wheel/bdist_wheel.py", line 155, in get_tag
assert tag == supported_tags[0]
AssertionError

Failed building wheel for ariba

Report "partial" when 1 contig but not full gene. This is different to 'fragmented'.

Currently the nose tests seem to assume that SPAdes is used and available, which breaks the test runs on systems without it. It would be nice to have conditional testing of the assembly function for SPAdes and/or Velvet.
I would like to run the tests as part of a Debian package build, and Debian does not have SPAdes available to depend on (yet).

Hello!

I'm hoping you can help me with some confusing error behavior. I am consistently receiving the following error on runs of ARIBA (version info listed below) and I'm out of ideas in looking for the source. My pipeline calls ARIBA on a dataset of 65 isolates, I receive this error on approx. 30% of ARIBA runs. This error does not persist with the same isolates at the same cluster if I rerun the isolate. Also, not the second error thrown during the handling of the original error.

Have you seen this issue before? Is this potentially an issue with my dependencies?

Thank you for your time!

Gretchen

Error Output

Stopping! Signal received: 28
Failed cluster: CRP
Finished running cluster CRP in directory /home/wilsonge/MyPrograms/vdh_amd_project/card.ariba.90%ID.2017-07-20/SRR1648160/RUN/ariba.tmp.a31cj4io/CRP
Deleting cluster dir /home/wilsonge/MyPrograms/vdh_amd_project/card.ariba.90%ID.2017-07-20/SRR1648160/RUN/ariba.tmp.a31cj4io/CRP
Other clusters failed. Will not start cluster Chlamydophila_psittaci_16S
Other clusters failed. Will not start cluster Enterobacter_aerogenes_omp36
Other clusters failed. Will not start cluster Escherichia_coli_EF_Tu
Other clusters failed. Will not start cluster Escherichia_coli_UhpT
Other clusters failed. Will not start cluster H_NS
Other clusters failed. Will not start cluster Helicobacter_pylori_16S
Other clusters failed. Will not start cluster Klebsiella_OmpK36_conferring
Other clusters failed. Will not start cluster MdtK
Other clusters failed. Will not start cluster Mycobacterium_abscessus_16S+
Other clusters failed. Will not start cluster Neisseria_-
Other clusters failed. Will not start cluster Pasteurella_multocida_16S
Other clusters failed. Will not start cluster Propionibacterium_acnes_16S
Other clusters failed. Will not start cluster TolC
Other clusters failed. Will not start cluster acrA
Other clusters failed. Will not start cluster acrA_1
Other clusters failed. Will not start cluster acrA_2
Other clusters failed. Will not start cluster acrB
Other clusters failed. Will not start cluster bacA
Other clusters failed. Will not start cluster cpxA
Other clusters failed. Will not start cluster emrB
Other clusters failed. Will not start cluster emrR
Other clusters failed. Will not start cluster fabI
Other clusters failed. Will not start cluster golS
Other clusters failed. Will not start cluster gyrA_6
Other clusters failed. Will not start cluster gyrA_7
Other clusters failed. Will not start cluster gyrB_1
Other clusters failed. Will not start cluster gyrB_2
Other clusters failed. Will not start cluster kdpE
Other clusters failed. Will not start cluster mdsA
Other clusters failed. Will not start cluster mdsB
Other clusters failed. Will not start cluster mdsC
Other clusters failed. Will not start cluster murA_2
Other clusters failed. Will not start cluster ompF
Other clusters failed. Will not start cluster parC_2
Other clusters failed. Will not start cluster parC_3
Other clusters failed. Will not start cluster parE_1
Other clusters failed. Will not start cluster parE_2
Other clusters failed. Will not start cluster ramR
Other clusters failed. Will not start cluster rpoB
Other clusters failed. Will not start cluster rrsB+
Other clusters failed. Will not start cluster sdiA
Other clusters failed. Will not start cluster soxR_1
Other clusters failed. Will not start cluster soxS
Finished assembling clusters

Traceback (most recent call last):
  File "/usr/local/lib/python3.5/dist-packages/ariba/clusters.py", line 546, in run
    self._run()
  File "/usr/local/lib/python3.5/dist-packages/ariba/clusters.py", line 579, in _run
    raise Error('At least one cluster failed! Stopping...')
ariba.clusters.Error: At least one cluster failed! Stopping...

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/home/wilsonge/ariba-2.10.0/scripts/ariba", line 292, in <module>
    args.func(args)
  File "/usr/local/lib/python3.5/dist-packages/ariba/tasks/run.py", line 63, in run
    c.run()
  File "/usr/local/lib/python3.5/dist-packages/ariba/clusters.py", line 549, in run
    raise Error('Something went wrong during ariba run. Cannot continue. Error was:\n' + str(err))
ariba.clusters.Error: Something went wrong during ariba run. Cannot continue. Error was:
At least one cluster failed! Stopping...
Error in sys.excepthook:
Traceback (most recent call last):
  File "/usr/lib/python3/dist-packages/apport_python_hook.py", line 67, in apport_excepthook
    binary = os.path.realpath(os.path.join(os.getcwd(), sys.argv[0]))
FileNotFoundError: [Errno 2] No such file or directory

Original exception was:
Traceback (most recent call last):
  File "/usr/local/lib/python3.5/dist-packages/ariba/clusters.py", line 546, in run
    self._run()
  File "/usr/local/lib/python3.5/dist-packages/ariba/clusters.py", line 579, in _run
    raise Error('At least one cluster failed! Stopping...')
ariba.clusters.Error: At least one cluster failed! Stopping...

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/home/wilsonge/ariba-2.10.0/scripts/ariba", line 292, in <module>
    args.func(args)
  File "/usr/local/lib/python3.5/dist-packages/ariba/tasks/run.py", line 63, in run
    c.run()
  File "/usr/local/lib/python3.5/dist-packages/ariba/clusters.py", line 549, in run
    raise Error('Something went wrong during ariba run. Cannot continue. Error was:\n' + str(err))
ariba.clusters.Error: Something went wrong during ariba run. Cannot continue. Error was:
At least one cluster failed! Stopping...

Version Info

ARIBA version: 2.10.0

External dependencies:
bowtie2	2.2.6	/usr/bin/bowtie2
cdhit	4.6	/usr/bin/cdhit-est
nucmer	3.1	/usr/bin/nucmer

External dependencies OK: True

Python version:
3.5.2 (default, Nov 17 2016, 17:05:23) 
[GCC 5.4.0 20160609]

Python packages:
ariba	2.10.0	/usr/local/lib/python3.5/dist-packages/ariba/__init__.py
bs4	4.4.1	/usr/lib/python3/dist-packages/bs4/__init__.py
dendropy	4.2.0	/usr/local/lib/python3.5/dist-packages/dendropy/__init__.py
pyfastaq	3.15.0	/usr/local/lib/python3.5/dist-packages/pyfastaq/__init__.py
pymummer	0.10.2	/usr/local/lib/python3.5/dist-packages/pymummer/__init__.py
pysam	0.11.2.2	/usr/local/lib/python3.5/dist-packages/pysam/__init__.py

Python packages OK: True

Everything looks OK: True

Dear developers,

I am excited to use ARIBA program, I have a question though about how exactly input files.
In the manual it says "ariba run prepareref_dir, reads_1, reads_2, outdir"
Suppose I have f1-for, f2-for, f3-for and f1-rev, f2-rev, f3-rev; How can I specify ariba to assemble them together (pooled)?

Many thanks
Vadim D

Recently updated ariba from 2.10.1 and noticed this issue emerge. Running on our installed resfinder DB has no issues however running others such as a mlst db or virulence finder leads to issues, see below). All mlst DBs were updated on Nov 23 (and custom ones added the clonal_complex) Adding the option for --noclean causes no errors to be generated.

Traceback (most recent call last):
  File "/tools/linuxbrew/opt/python3/lib/python3.6/site-packages/ariba/clusters.py", line 546, in run
    self._run()
  File "/tools/linuxbrew/opt/python3/lib/python3.6/site-packages/ariba/clusters.py", line 579, in _run
    raise Error('At least one cluster failed! Stopping...')
ariba.clusters.Error: At least one cluster failed! Stopping...
During handling of the above exception, another exception occurred:
Traceback (most recent call last):
  File "/tools/linuxbrew/bin/ariba", line 292, in <module>
    args.func(args)
  File "/tools/linuxbrew/opt/python3/lib/python3.6/site-packages/ariba/tasks/run.py", line 63, in run
    c.run()
  File "/tools/linuxbrew/opt/python3/lib/python3.6/site-packages/ariba/clusters.py", line 549, in run
    raise Error('Something went wrong during ariba run. Cannot continue. Error was:\n' + str(err))
ariba.clusters.Error: Something went wrong during ariba run. Cannot continue. Error was:
At least one cluster failed! Stopping...

--tmp_dir TMP_DIR     Existing directory in which to create a temporary
                        directory used for local assemblies

Can this default to the Unix standard $TMPDIR ?
(instead of .)

When I try to use ariba getref card out.card I get this error:

Downloading "https://card.mcmaster.ca/download" and saving as "download.html" ...Traceback (most recent call last):
File "/Library/Frameworks/Python.framework/Versions/3.6/bin/ariba", line 231, in
args.func(args)
File "/Library/Frameworks/Python.framework/Versions/3.6/lib/python3.6/site-packages/ariba/tasks/getref.py", line 11, in run
getter.run(options.outprefix)
File "/Library/Frameworks/Python.framework/Versions/3.6/lib/python3.6/site-packages/ariba/ref_genes_getter.py", line 429, in run
exec('self.get_from' + self.ref_db + '(outprefix)')
File "", line 1, in
File "/Library/Frameworks/Python.framework/Versions/3.6/lib/python3.6/site-packages/ariba/ref_genes_getter.py", line 76, in _get_from_card
versions = self._get_card_versions('download.html')
File "/Library/Frameworks/Python.framework/Versions/3.6/lib/python3.6/site-packages/ariba/ref_genes_getter.py", line 42, in _get_card_versions
common.download_file('https://card.mcmaster.ca/download', tmp_file, max_attempts=self.max_download_attempts, sleep_time=self.sleep_time, verbose=True)
File "/Library/Frameworks/Python.framework/Versions/3.6/lib/python3.6/site-packages/ariba/common.py", line 67, in download_file
raise Error('Error downloading: ' + url)
ariba.common.Error: Error downloading: https://card.mcmaster.ca/download

You convert everything to underscores but don't report the original names.

Thanks for a great program. I’m new at linux and ariba so this might be stupid question. I wonder what is the command for setting spades as the assembler when performing a run.

I thought it was “ariba run [--assembler spades] ref reads_1.fq reads_2.fq output_dir

but I get error argument.

I also wonder if its possible to set a minimum coverage? We experience carryover between some sample when doing multiplexing in Illumina and we get a hit on genes we know are wrong, with few reads (around 5-10) and ctg_cov around 1-2.

Thanks for the help

Hi, I'm trying to install your software but I have a lot of problems. When I run "python3 setup.py test" there are some problems to find SPAdes and CD-HIT, I have those programs added to the path and working properly... but test is no able to find them, in "external_progs.py" CD-HIT is called "cd-hit-est", but when I installed CD-HIT this is called "cdhit-est".
About SPAdes, I don't understand why, if I have v3.8.0, in the log output, test called the address like '/foo/bar/SPAdes-3.6.0-Linux/bin/spades'....
I really got lost, I don't know what to do, I'll be very grateful if you can help me!

genetica@UBGENETICA:~/Documentos/Software/ariba-master$ python3 setup.py test
test_check_coding_seq (aln_to_metadata_test.TestAlnToMetadata)
test _check_coding_seq ... ok
test_check_insertion_coords (aln_to_metadata_test.TestAlnToMetadata)
test _check_insertion_coords ... ok
test_check_seq_lengths_same (aln_to_metadata_test.TestAlnToMetadata)
test _check_seq_lengths_same ... ok
test_check_sequences_coding (aln_to_metadata_test.TestAlnToMetadata)
test _check_sequences with coding seqs ... ok
test_check_sequences_non_coding (aln_to_metadata_test.TestAlnToMetadata)
test _check_sequences with noncoding seqs ... ok
test_check_variants_match_sequences (aln_to_metadata_test.TestAlnToMetadata)
test _check_variants_match_sequences ... ok
test_insertion_coords (aln_to_metadata_test.TestAlnToMetadata)
test _insertion_coords ... ok
test_load_aln_file (aln_to_metadata_test.TestAlnToMetadata)
test _load_aln_file ... ok
test_load_vars_bad_files (aln_to_metadata_test.TestAlnToMetadata)
test _load_vars_file bad input files ... ok
test_load_vars_file_good_file (aln_to_metadata_test.TestAlnToMetadata)
test _load_vars_file good input file ... ok
test_make_cluster_file (aln_to_metadata_test.TestAlnToMetadata)
test _make_cluster_file ... ok
test_make_unpadded_insertion_coords (aln_to_metadata_test.TestAlnToMetadata)
test _make_unpadded_insertion_coords ... ok
test_make_unpadded_seqs (aln_to_metadata_test.TestAlnToMetadata)
test _make_unpadded_seqs ... ok
test_padded_to_unpadded_nt_position (aln_to_metadata_test.TestAlnToMetadata)
test _padded_to_unpadded_nt_position ... ok
test_run_coding (aln_to_metadata_test.TestAlnToMetadata)
test run coding sequences ... Warning: position has a gap in sequence seq3 corresponding to variant A2D (id1) in sequence seq1 ... Ignoring for seq3
Warning: position has a gap in sequence seq1 corresponding to variant F2E (id2) in sequence seq5 ... Ignoring for seq1
Warning: position has a gap in sequence seq2 corresponding to variant F2E (id2) in sequence seq5 ... Ignoring for seq2
ok
test_run_noncoding (aln_to_metadata_test.TestAlnToMetadata)
test run noncoding sequences ... Warning: position has a gap in sequence seq3 corresponding to variant C5T (id1) in sequence seq1 ... Ignoring for seq3
Warning: position has a gap in sequence seq1 corresponding to variant A5T (id2) in sequence seq5 ... Ignoring for seq1
Warning: position has a gap in sequence seq2 corresponding to variant A5T (id2) in sequence seq5 ... Ignoring for seq2
ok
test_unpadded_to_padded_nt_position (aln_to_metadata_test.TestAlnToMetadata)
test _unpadded_to_padded_nt_position ... ok
test_variant_ids_are_unique (aln_to_metadata_test.TestAlnToMetadata)
test variant_ids_are_unique ... ok
test_variants_to_tsv_lines_coding (aln_to_metadata_test.TestAlnToMetadata)
test _variants_to_tsv_lines coding sequences ... Warning: position has a gap in sequence seq3 corresponding to variant A2D (id1) in sequence seq1 ... Ignoring for seq3
Warning: position has a gap in sequence seq1 corresponding to variant F2E (id2) in sequence seq5 ... Ignoring for seq1
Warning: position has a gap in sequence seq2 corresponding to variant F2E (id2) in sequence seq5 ... Ignoring for seq2
ok
test_variants_to_tsv_lines_noncoding (aln_to_metadata_test.TestAlnToMetadata)
test _variants_to_tsv_lines noncoding sequences ... Warning: position has a gap in sequence seq3 corresponding to variant C5T (id1) in sequence seq1 ... Ignoring for seq3
Warning: position has a gap in sequence seq1 corresponding to variant A5T (id2) in sequence seq5 ... Ignoring for seq1
Warning: position has a gap in sequence seq2 corresponding to variant A5T (id2) in sequence seq5 ... Ignoring for seq2
ok
test_find_next_stop_codon (assembly_compare_test.TestAssemblyCompare)
test _find_next_stop_codon ... ok
test_find_previous_start_codon (assembly_compare_test.TestAssemblyCompare)
test _find_previous_start_codon ... ok
test_gene_from_nucmer_match (assembly_compare_test.TestAssemblyCompare)
test _gene_from_nucmer_match ... ok
test_get_assembled_reference_sequences (assembly_compare_test.TestAssemblyCompare)
test _get_assembled_reference_sequences ... ok
test_get_gene_matching_ref (assembly_compare_test.TestAssemblyCompare)
test _get_gene_matching_ref ... ok
test_longest_nucmer_hit_in_ref (assembly_compare_test.TestAssemblyCompare)
test _longest_nucmer_hit_in_ref ... ok
test_nucmer_hit_containing_reference_position (assembly_compare_test.TestAssemblyCompare)
test nucmer_hit_containing_reference_position ... ok
test_nucmer_hits_to_assembly_coords (assembly_compare_test.TestAssemblyCompare)
test _nucmer_hits_to_assembly_coords ... ok
test_nucmer_hits_to_percent_identity (assembly_compare_test.TestAssemblyCompare)
test _nucmer_hits_to_percent_identity ... ok
test_nucmer_hits_to_ref_coords (assembly_compare_test.TestAssemblyCompare)
test nucmer_hits_to_ref_coords ... ok
test_parse_nucmer_coords_file (assembly_compare_test.TestAssemblyCompare)
test _parse_nucmer_coords_file ... ok
test_ref_cov_per_contig (assembly_compare_test.TestAssemblyCompare)
test ref_cov_per_contig ... ok
test_ref_covered_by_at_least_one_full_length_contig (assembly_compare_test.TestAssemblyCompare)
test _ref_covered_by_at_least_one_full_length_contig ... ok
test_ref_has_region_assembled_twice (assembly_compare_test.TestAssemblyCompare)
test _ref_has_region_assembled_twice ... ok
test_whole_gene_covered_by_nucmer_hits (assembly_compare_test.TestAssemblyCompare)
test _whole_gene_covered_by_nucmer_hits ... ok
test_assemble_with_spades (assembly_test.TestAssembly)
test _assemble_with_spades ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
test_assemble_with_spades_fail (assembly_test.TestAssembly)
test _assemble_with_spades handles spades fail ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
test_check_spades_log_file (assembly_test.TestAssembly)
test _check_spades_log_file ... Error running SPAdes. Cannot continue. This is the error from the log file /home/genetica/Documentos/Software/ariba-master/ariba/tests/data/assembly_test_check_spades_log_file.log.bad ...
== Error == system call for: "['/foo/bar/SPAdes-3.6.0-Linux/bin/spades', '/spam/eggs/K21/configs/config.info']" finished abnormally, err code: -7

ok
test_fix_contig_orientation (assembly_test.TestAssembly)
test _fix_contig_orientation ... ok
test_gap_fill_with_gapfiller_no_gaps (assembly_test.TestAssembly)
test _gap_fill_with_gapfiller no gaps ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
test_gap_fill_with_gapfiller_with_gaps (assembly_test.TestAssembly)
test _gap_fill_with_gapfiller with gaps ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
test_get_assembly_kmer (assembly_test.TestAssembly)
test _get_assembly_kmer ... ok
test_has_gaps_to_fill (assembly_test.TestAssembly)
test _has_gaps_to_fill ... ok
test_parse_bam (assembly_test.TestAssembly)
test _parse_bam ... ok
test_rename_scaffolds (assembly_test.TestAssembly)
test _rename_scaffolds ... ok
test_scaffold_with_sspace (assembly_test.TestAssembly)
test _scaffold_with_sspace ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
test_filter_mummer_variants (assembly_variants_test.TestAssemblyVariants)
test filter_mummer_variants ... ok
test_get_codon_start (assembly_variants_test.TestAssemblyVariants)
test _get_codon_start ... ok
test_get_mummer_variants_has_variants (assembly_variants_test.TestAssemblyVariants)
test _get_mummer_variants when there are variants ... ok
test_get_mummer_variants_no_variants (assembly_variants_test.TestAssemblyVariants)
test _get_mummer_variants when no variants ... ok
test_get_one_variant_for_one_contig_coding (assembly_variants_test.TestAssemblyVariants)
test _get_one_variant_for_one_contig_coding ... ok
test_get_one_variant_for_one_contig_non_coding (assembly_variants_test.TestAssemblyVariants)
test _get_one_variant_for_one_contig_non_coding ... ok
test_get_remaining_known_ref_variants_amino_acids (assembly_variants_test.TestAssemblyVariants)
test _get_remaining_known_ref_variants with amino acids ... ok
test_get_remaining_known_ref_variants_nucleotides (assembly_variants_test.TestAssemblyVariants)
test _get_remaining_known_ref_variants with nucleotides ... ok
test_get_variant_effect (assembly_variants_test.TestAssemblyVariants)
test _get_variant_effect ... ok
test_get_variants_presence_absence (assembly_variants_test.TestAssemblyVariants)
test get_variants presence absence genes ... ok
test_get_variants_variants_only (assembly_variants_test.TestAssemblyVariants)
test get_variants variants only ... ok
test_parse (bam_parse_test.TestBamParse)
test parse ... ok
test_sam_to_soft_clipped (bam_parse_test.TestBamParse)
test _sam_to_soft_clipped ... ok
test_update_soft_clipped_from_sam (bam_parse_test.TestBamParse)
test _update_soft_clipped_from_sam ... ok
test_update_unmapped_mates_from_sam (bam_parse_test.TestBamParse)
test _update_unmapped_mates_from_sam ... ok
test_write_soft_clipped_to_file (bam_parse_test.TestBamParse)
test _write_soft_clipped_to_file ... ok
test_write_unmapped_mates_to_file (bam_parse_test.TestBamParse)
test _write_unmapped_mates_to_file ... ok
WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
Failure: Error (Dependency error(s). Cannot continue) ... ERROR
test_ARO_accession (card_record_test.TestCardRecord)
test _ARO_accession ... ok
test_ARO_description (card_record_test.TestCardRecord)
test _ARO_description ... ok
test_ARO_id (card_record_test.TestCardRecord)
test _ARO_id ... ok
test_ARO_name (card_record_test.TestCardRecord)
test _ARO_name ... ok
test_ARO_name_to_fasta_name (card_record_test.TestCardRecord)
test _ARO_name_to_fasta_name ... ok
test_dna_seqs_and_genbank_ids (card_record_test.TestCardRecord)
test _dna_seqs_and_genbank_ids ... Missing data from foo
Missing data from foo
Missing data from foo
Missing data from foo
Missing data from foo
Missing data from foo
Missing data from foo
ok
test_get_data (card_record_test.TestCardRecord) ... ok
test_snps (card_record_test.TestCardRecord)
test snps ... ok
WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
Failure: Error (Dependency error(s). Cannot continue) ... ERROR
test_full_run_assembly_fail (cluster_test.TestCluster)
test complete run of cluster when assembly fails ... ERROR
test_full_run_choose_ref_fail (cluster_test.TestCluster)
test complete run of cluster when choosing ref seq fails ... ERROR
test_full_run_ok_non_coding (cluster_test.TestCluster)
test complete run of cluster on a noncoding sequence ... ERROR
test_full_run_ok_presence_absence (cluster_test.TestCluster)
test complete run of cluster on a presence absence gene ... ERROR
test_full_run_ok_variants_only_variant_is_present (cluster_test.TestCluster)
test complete run of cluster on a variants only gene when variant is present ... ERROR
test_full_run_ok_variants_only_variant_not_present (cluster_test.TestCluster)
test complete run of cluster on a variants only gene when variant not present ... ERROR
test_full_run_ok_variants_only_variant_not_present_always_report (cluster_test.TestCluster)
test complete run of cluster on a variants only gene when variant not present but always report variant ... ERROR
test_init_fail_files_missing (cluster_test.TestCluster)
test init_fail_files_missing ... ok
test_make_reads_for_assembly_proper_sample (cluster_test.TestCluster)
Test _make_reads_for_assembly when sampling from reads ... ok
test_make_reads_for_assembly_symlinks (cluster_test.TestCluster)
Test _make_reads_for_assembly when just makes symlinks ... ok
test_number_of_reads_for_assembly (cluster_test.TestCluster)
Test _number_of_reads_for_assembly ... ok
WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
Failure: Error (Dependency error(s). Cannot continue) ... ERROR
test_cat_files (common_test.TestCommon)
test cat_files ... ok
test_external_progs_ok (external_progs_test.TestExternalProgs)
Test that external programs are found ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
Failure: Error (Dependency error(s). Cannot continue) ... ERROR
test_add (flag_test.TestFlag)
Test add ... ok
test_has (flag_test.TestFlag)
Test has ... ok
test_init_and_to_number (flag_test.TestFlag)
Test init and to_number ... ok
test_set_flag (flag_test.TestFlag)
Test set_flag ... ok
test_str (flag_test.TestFlag)
Test str ... ok
test_to_long_str (flag_test.TestFlag)
Test to_long_str ... ok
test_add (histogram_test.TestCluster)
Test add ... ok
test_len (histogram_test.TestCluster)
Test len ... ok
test_stats (histogram_test.TestCluster)
Test stats ... ok
test_to_bin (histogram_test.TestCluster)
Test _to_bin ... ok
test_distance_to_contig_end (link_test.TestLink)
test _distance_to_contig_end ... ok
test_distance_to_contig_ends (link_test.TestLink)
test _distance_to_contig_ends ... ok
test_init_no_links (link_test.TestLink)
test link init no links made ... ok
test_init_with_link (link_test.TestLink)
test link init link made ... ok
test_insert_size (link_test.TestLink)
test insert_size ... ok
test_lt (link_test.TestLink)
test lt ... ok
test_merge (link_test.TestLink)
test merge ... ok
test_sort (link_test.TestLink)
test sort ... ok
test_swap (link_test.TestLink)
test _swap ... ok
WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
Failure: Error (Dependency error(s). Cannot continue) ... ERROR
test_clean (read_store_test.TestReadStore)
Test clean ... ok
test_compress_and_index_file (read_store_test.TestReadStore)
Test _compress_and_index_file ... ok
test_get_reads (read_store_test.TestReadStore)
Test get_reads ... ok
test_sort_file (read_store_test.TestReadStore)
test _sort_file ... ok
test_get_ref_files_naming_each_file (ref_preparer_test.TestRefPreparer) ... ok
test_get_ref_files_ref_prefix (ref_preparer_test.TestRefPreparer)
test _get_ref_files using ref_prefix ... ok
test_write_info_file (ref_preparer_test.TestRefPreparer)
test _write_info_file ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ERROR
test_all_non_wild_type_variants (reference_data_test.TestReferenceData)
Test all_non_wild_type_variants ... ok
test_cluster_with_cdhit (reference_data_test.TestReferenceData)
Test cluster_with_cd_hit ... The following command failed with exit code 127
cd-hit-est -i /home/genetica/Documentos/Software/ariba-master/ariba/tests/data/reference_data_test_cluster_with_cdhit.presence_absence.fa -o /home/genetica/Documentos/Software/ariba-master/tmp.run_cd-hit.dj970f6i/cdhit -c 0.9 -T 1 -s 0.9 -d 0 -bak 1

The output was:

/bin/sh: 1: cd-hit-est: not found

ERROR
test_cluster_with_cdhit_clusters_in_file (reference_data_test.TestReferenceData)
Test cluster_with_cd_hit clusters from file ... ok
test_dict_keys_intersection (reference_data_test.TestReferenceData)
Test dict_keys_intersection ... ok
test_filter_bad_variant_data (reference_data_test.TestReferenceData)
Test _filter_bad_variant_data ... ok
test_find_gene_in_seqs (reference_data_test.TestReferenceData)
Test _find_gene_in_seqs ... ok
test_get_filename (reference_data_test.TestReferenceData)
Test _get_filename ... ok
test_init_fails (reference_data_test.TestReferenceData)
Test init fails when it should ... ok
test_init_ok (reference_data_test.TestReferenceData)
Test init with good input ... ok
test_load_fasta_file (reference_data_test.TestReferenceData)
Test _load_fasta_file ... ok
test_load_metadata_tsv (reference_data_test.TestReferenceData)
Test _load_metadata_tsv ... ok
test_make_catted_fasta (reference_data_test.TestReferenceData)
Test make_catted_fasta ... ok
test_new_seq_name (reference_data_test.TestReferenceData)
Test _new_seq_name ... ok
test_remove_bad_genes (reference_data_test.TestReferenceData)
Test _remove_bad_genes ... ok
test_rename_metadata_set (reference_data_test.TestReferenceData)
Test _rename_metadata_set ... ok
test_rename_names_in_metadata (reference_data_test.TestReferenceData)
Test _rename_names_in_metadata ... ok
test_rename_names_in_seq_dicts (reference_data_test.TestReferenceData)
Test _rename_names_in_seq_dicts ... ok
test_rename_sequences (reference_data_test.TestReferenceData)
Test rename_sequences ... Had to rename some sequences. See tmp.test_rename_sequences.out for old -> new names
ok
test_seq_names_to_rename_dict (reference_data_test.TestReferenceData)
Test _seq_names_to_rename_dict ... ok
test_sequence (reference_data_test.TestReferenceData)
Test sequence ... ok
test_sequence_length (reference_data_test.TestReferenceData)
Test sequence_length ... ok
test_sequence_type (reference_data_test.TestReferenceData)
Test sequence_type ... ok
test_try_to_get_gene_seq (reference_data_test.TestReferenceData)
Test _try_to_get_gene_seq ... ok
test_write_cluster_allocation_file (reference_data_test.TestReferenceData)
Test write_cluster_allocation_file ... ok
test_write_dict_of_sequences (reference_data_test.TestReferenceData)
Test _write_dict_of_sequences ... ok
test_write_metadata_tsv (reference_data_test.TestReferenceData)
Test _write_metadata_tsv ... ok
test_write_seqs_to_fasta (reference_data_test.TestReferenceData)
Test write_seqs_to_fasta ... ok
test_dict_to_report_line (report_filter_test.TestReportFilter)
Test _dict_to_report_line ... ok
test_filter_dicts (report_filter_test.TestReportFilter)
Test _filter_dicts ... ok
test_filter_list_of_dicts_all_fail (report_filter_test.TestReportFilter)
Test _filter_list_of_dicts where all fail ... ok
test_filter_list_of_dicts_with_essential (report_filter_test.TestReportFilter)
Test _filter_list_of_dicts with an essential line but all others fail ... ok
test_filter_list_of_dicts_with_pass (report_filter_test.TestReportFilter)
Test _filter_list_of_dicts with a line that passes ... ok
test_flag_passes_filter (report_filter_test.TestReportFilter)
Test _flag_passes_filter ... ok
test_init_bad_file (report_filter_test.TestReportFilter)
test init on bad input file ... ok
test_init_good_file (report_filter_test.TestReportFilter)
test init on good input file ... ok
test_load_report (report_filter_test.TestReportFilter) ... ok
test_remove_all_after_first_frameshift (report_filter_test.TestReportFilter)
Test _remove_all_after_first_frameshift ... ok
test_report_dict_passes_essential_filters (report_filter_test.TestReportFilter)
Test _report_dict_passes_essential_filters ... ok
test_report_dict_passes_non_essential_filters_known_vars (report_filter_test.TestReportFilter)
Test _report_dict_passes_non_essential_filters with known vars ... ok
test_report_dict_passes_non_essential_filters_synonymous (report_filter_test.TestReportFilter)
Test _report_dict_passes_non_essential_filters with synonymous AA changes ... ok
test_report_line_to_dict (report_filter_test.TestReportFilter) ... ok
test_run (report_filter_test.TestReportFilter)
Test run ... ok
test_write_report_tsv (report_filter_test.TestReportFilter)
Test write_report_tsv ... ok
WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
Failure: Error (Dependency error(s). Cannot continue) ... ERROR
test_contig_graph_is_consistent (scaffold_graph_test.TestScaffoldGraph)
test _contig_graph_is_consistent ... ok
test_make_graph (scaffold_graph_test.TestScaffoldGraph)
test _make_graph ... ok
test_remove_low_cov_links (scaffold_graph_test.TestScaffoldGraph)
test _remove_low_cov_links ... ok
test_update_from_sam (scaffold_graph_test.TestScaffoldGraph)
test update_from_sam ... ok
test_write_all_links_to_file (scaffold_graph_test.TestScaffoldGraph)
test write_all_links_to_file ... ok
test_has_variant (sequence_metadata_test.TestSequenceMetadata)
test has_variant ... ok
test_init_fails_on_bad_lines (sequence_metadata_test.TestSequenceMetadata)
Test init fails on bad lines ... ok
test_init_on_good_input (sequence_metadata_test.TestSequenceMetadata)
test init ok on good input ... ok
test_str (sequence_metadata_test.TestSequenceMetadata)
test str ... ok
test_to_string (sequence_metadata_test.TestSequenceMetadata)
test to_string ... ok
test_has_variant (sequence_variant_test.TestSequenceVariant)
test has_variant ... ok
test_init_fails_on_bad_variant_strings (sequence_variant_test.TestSequenceVariant)
Test init fails on bad variant strings ... ok
test_init_ok (sequence_variant_test.TestSequenceVariant)
Test init ok ... ok
test_init_str (sequence_variant_test.TestSequenceVariant)
Test init ok and str ... ok
test_nucleotide_range (sequence_variant_test.TestSequenceVariant)
test nucleotide_range ... ok
test_sanity_check_against_seq_no_translate (sequence_variant_test.TestSequenceVariant)
test sanity_check_against_seq with translate False ... ok
test_sanity_check_against_seq_translate (sequence_variant_test.TestSequenceVariant)
test sanity_check_against_seq with translate True ... ok
test_add_data_dict (summary_cluster_test.TestSummaryCluster)
Test add_data_dict ... ok
test_column_summary_data (summary_cluster_test.TestSummaryCluster)
Test column_summary_data ... ok
test_get_nonsynonymous_var (summary_cluster_test.TestSummaryCluster)
Test _get_nonsynonymous_var ... ok
test_has_any_known_variant (summary_cluster_test.TestSummaryCluster) ... ok
test_has_any_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _has_any_nonsynonymous ... ok
test_has_any_novel_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _has_any_novel_nonsynonymous ... ok
test_has_known_variant (summary_cluster_test.TestSummaryCluster)
Test _has_known_variant ... ok
test_has_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _has_nonsynonymous ... ok
test_has_novel_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _has_novel_nonsynonymous ... ok
test_has_resistance (summary_cluster_test.TestSummaryCluster)
Test _has_resistance ... ok
test_has_var_groups (summary_cluster_test.TestSummaryCluster)
Test has_var_groups ... ok
test_line2dict (summary_cluster_test.TestSummaryCluster)
Test _line2dict ... ok
test_non_synon_variants (summary_cluster_test.TestSummaryCluster)
Test non_synon_variants ... ok
test_pc_id_of_longest (summary_cluster_test.TestSummaryCluster)
Test pc_id_of_longest ... ok
test_to_cluster_summary_has_known_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _to_cluster_summary_has_known_nonsynonymous ... ok
test_to_cluster_summary_has_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _to_cluster_summary_has_nonsynonymous ... ok
test_to_cluster_summary_has_novel_nonsynonymous (summary_cluster_test.TestSummaryCluster)
Test _to_cluster_summary_has_novel_nonsynonymous ... ok
test_to_cluster_summary_number (summary_cluster_test.TestSummaryCluster)
Test _to_cluster_summary_assembled ... ok
test_column_summary_data (summary_sample_test.TestSummarySample)
Test _column_summary_data ... ok
test_load_file (summary_sample_test.TestSummarySample)
Test _load_file ... ok
test_var_groups (summary_sample_test.TestSummarySample)
test _var_groups ... ok
test_variant_column_names_tuples (summary_sample_test.TestSummarySample)
Test _variant_column_names_tuples ... ok
test_add_phandango_colour_columns (summary_test.TestSummary)
Test _add_phandango_colour_columns ... ok
test_determine_cluster_cols (summary_test.TestSummary) ... ok
test_determine_var_cols (summary_test.TestSummary) ... ok
test_distance_score_between_lists (summary_test.TestSummary)
Test _distance_score_between_lists ... ok
test_distance_score_bewteen_values (summary_test.TestSummary)
Test _distance_score_bewteen_values ... ok
test_filter_matrix_columns (summary_test.TestSummary)
Test _filter_matrix_columns ... ok
test_filter_matrix_rows (summary_test.TestSummary)
Test _filter_matrix_rows ... ok
test_gather_output_rows (summary_test.TestSummary)
Test _gather_output_rows ... ok
test_get_all_cluster_names (summary_test.TestSummary)
Test _get_all_cluster_names ... ok
test_get_all_var_groups (summary_test.TestSummary)
test _get_all_var_groups ... ok
test_get_all_variant_columns (summary_test.TestSummary)
Test _get_all_variant_columns ... ok
test_init (summary_test.TestSummary)
Test init ... ok
test_load_input_files (summary_test.TestSummary)
Test _load_input_files ... ok
test_matrix_to_csv (summary_test.TestSummary)
Test _matrix_to_csv ... ok
test_newick_from_dist_matrix (summary_test.TestSummary)
Test _newick_from_dist_matrix ... ok
test_to_matrix (summary_test.TestSummary)
Test _to_matrix ... ok
test_write_distance_matrix (summary_test.TestSummary)
Test _write_distance_matrix ... ok
test_get_all_versions (versions_test.TestVersions)
Test get_all_versions ... WARNING: gapfiller not found in path. Looked for GapFiller.pl. But it is optional so will be skipped during assembly
WARNING: sspace not found in path. Looked for SSPACE_Basic_v2.0.pl. But it is optional so will be skipped during assembly
ERROR: cdhit not found in path. Looked for cd-hit-est

Something wrong with at least one dependency. Please see the above error message(s)
ok
test_fa_header_to_name_and_metadata (vfdb_parser_test.TestVfdbParser)
test _fa_header_to_name_and_metadata ... ok
test_fa_header_to_name_pieces (vfdb_parser_test.TestVfdbParser)
test _fa_header_to_name_pieces ... ok
test_run (vfdb_parser_test.TestVfdbParser)
test run ... ok

ERROR: test_assemble_with_spades (assembly_test.TestAssembly)

test _assemble_with_spades

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/assembly_test.py", line 39, in test_assemble_with_spades
a = assembly.Assembly(reads1, reads2, ref_fasta, tmp_dir, 'not_needed_for_this_test.fa', 'not_needed_for_this_test.bam', sys.stdout)
File "/home/genetica/Documentos/Software/ariba-master/ariba/assembly.py", line 61, in init
self.extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_assemble_with_spades_fail (assembly_test.TestAssembly)

test _assemble_with_spades handles spades fail

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/assembly_test.py", line 51, in test_assemble_with_spades_fail
a = assembly.Assembly(reads1, reads2, ref_fasta, tmp_dir, 'not_needed_for_this_test.fa', 'not_needed_for_this_test.bam', sys.stdout)
File "/home/genetica/Documentos/Software/ariba-master/ariba/assembly.py", line 61, in init
self.extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_gap_fill_with_gapfiller_no_gaps (assembly_test.TestAssembly)

test _gap_fill_with_gapfiller no gaps

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/assembly_test.py", line 93, in test_gap_fill_with_gapfiller_no_gaps
a = assembly.Assembly(reads1, reads2, 'ref.fa', tmp_dir, 'not_needed_for_this_test.fa', 'not_needed_for_this_test.bam', sys.stdout)
File "/home/genetica/Documentos/Software/ariba-master/ariba/assembly.py", line 61, in init
self.extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_gap_fill_with_gapfiller_with_gaps (assembly_test.TestAssembly)

test _gap_fill_with_gapfiller with gaps

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/assembly_test.py", line 105, in test_gap_fill_with_gapfiller_with_gaps
a = assembly.Assembly(reads1, reads2, 'ref.fa', tmp_dir, 'not_needed_for_this_test.fa', 'not_needed_for_this_test.bam', sys.stdout)
File "/home/genetica/Documentos/Software/ariba-master/ariba/assembly.py", line 61, in init
self.extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_scaffold_with_sspace (assembly_test.TestAssembly)

test _scaffold_with_sspace

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/assembly_test.py", line 63, in test_scaffold_with_sspace
a = assembly.Assembly(reads1, reads2, ref_fasta, tmp_dir, 'not_needed_for_this_test.fa', 'not_needed_for_this_test.bam', sys.stdout)
File "/home/genetica/Documentos/Software/ariba-master/ariba/assembly.py", line 61, in init
self.extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: Failure: Error (Dependency error(s). Cannot continue)

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/failure.py", line 39, in runTest
raise self.exc_val.with_traceback(self.tb)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/loader.py", line 418, in loadTestsFromName
addr.filename, addr.module)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 47, in importFromPath
return self.importFromDir(dir_path, fqname)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 94, in importFromDir
mod = load_module(part_fqname, fh, filename, desc)
File "/usr/lib/python3.4/imp.py", line 235, in load_module
return load_source(name, filename, file)
File "/usr/lib/python3.4/imp.py", line 171, in load_source
module = methods.load()
File "", line 1220, in load
File "", line 1200, in _load_unlocked
File "", line 1129, in _exec
File "", line 1471, in exec_module
File "", line 321, in _call_with_frames_removed
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/best_seq_chooser_test.py", line 9, in
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: Failure: Error (Dependency error(s). Cannot continue)

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/failure.py", line 39, in runTest
raise self.exc_val.with_traceback(self.tb)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/loader.py", line 418, in loadTestsFromName
addr.filename, addr.module)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 47, in importFromPath
return self.importFromDir(dir_path, fqname)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 94, in importFromDir
mod = load_module(part_fqname, fh, filename, desc)
File "/usr/lib/python3.4/imp.py", line 235, in load_module
return load_source(name, filename, file)
File "/usr/lib/python3.4/imp.py", line 171, in load_source
module = methods.load()
File "", line 1220, in load
File "", line 1200, in _load_unlocked
File "", line 1129, in _exec
File "", line 1471, in exec_module
File "", line 321, in _call_with_frames_removed
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cdhit_test.py", line 8, in
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_full_run_assembly_fail (cluster_test.TestCluster)

test complete run of cluster when assembly fails

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 128, in test_full_run_assembly_fail
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_assembly_fail'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.test_full_run_assembly_fail'

ERROR: test_full_run_choose_ref_fail (cluster_test.TestCluster)

test complete run of cluster when choosing ref seq fails

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 110, in test_full_run_choose_ref_fail
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_choose_ref_fail'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.test_full_run_choose_ref_fail'

ERROR: test_full_run_ok_non_coding (cluster_test.TestCluster)

test complete run of cluster on a noncoding sequence

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 148, in test_full_run_ok_non_coding
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_non_coding'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.test_full_run_ok_non_coding'

ERROR: test_full_run_ok_presence_absence (cluster_test.TestCluster)

test complete run of cluster on a presence absence gene

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 174, in test_full_run_ok_presence_absence
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_presence_absence'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.cluster_test_full_run_ok_presence_absence'

ERROR: test_full_run_ok_variants_only_variant_is_present (cluster_test.TestCluster)

test complete run of cluster on a variants only gene when variant is present

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 238, in test_full_run_ok_variants_only_variant_is_present
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.cluster_test_full_run_ok_variants_only.present'

ERROR: test_full_run_ok_variants_only_variant_not_present (cluster_test.TestCluster)

test complete run of cluster on a variants only gene when variant not present

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 200, in test_full_run_ok_variants_only_variant_not_present
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.cluster_test_full_run_ok_variants_only.not_present'

ERROR: test_full_run_ok_variants_only_variant_not_present_always_report (cluster_test.TestCluster)

test complete run of cluster on a variants only gene when variant not present but always report variant

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/cluster_test.py", line 219, in test_full_run_ok_variants_only_variant_not_present_always_report
shutil.copytree(os.path.join(data_dir, 'cluster_test_full_run_ok_variants_only'), tmpdir)
File "/usr/lib/python3.4/shutil.py", line 303, in copytree
os.makedirs(dst)
File "/usr/lib/python3.4/os.py", line 237, in makedirs
mkdir(name, mode)
FileExistsError: [Errno 17] File exists: 'tmp.cluster_test_full_run_ok_variants_only.not_present.always_report'

ERROR: Failure: Error (Dependency error(s). Cannot continue)

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/failure.py", line 39, in runTest
raise self.exc_val.with_traceback(self.tb)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/loader.py", line 418, in loadTestsFromName
addr.filename, addr.module)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 47, in importFromPath
return self.importFromDir(dir_path, fqname)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 94, in importFromDir
mod = load_module(part_fqname, fh, filename, desc)
File "/usr/lib/python3.4/imp.py", line 235, in load_module
return load_source(name, filename, file)
File "/usr/lib/python3.4/imp.py", line 171, in load_source
module = methods.load()
File "", line 1220, in load
File "", line 1200, in _load_unlocked
File "", line 1129, in _exec
File "", line 1471, in exec_module
File "", line 321, in _call_with_frames_removed
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/clusters_test.py", line 12, in
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_external_progs_ok (external_progs_test.TestExternalProgs)

Test that external programs are found

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/external_progs_test.py", line 8, in test_external_progs_ok
progs = external_progs.ExternalProgs(verbose=True)
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
nose.proxy.Error: Dependency error(s). Cannot continue
-------------------- >> begin captured stdout << ---------------------
__________________ Checking dependencies and their versions ___________________
bcftools 1.3.1 /usr/local/bin/bcftools
bowtie2 2.2.5 /usr/bin/bowtie2
cdhit NA NOT_FOUND
gapfiller NA NOT_FOUND
nucmer 3.1 /usr/bin/nucmer
r 3.3.0 /usr/bin/Rscript
samtools 1.3.1 /usr/local/bin/samtools
spades .8.0 python2 /home/genetica/Documentos/Software/SPAdes-3.8.0-Linux/bin/spades.py
sspace NA NOT_FOUND

--------------------- >> end captured stdout << ----------------------

ERROR: Failure: Error (Dependency error(s). Cannot continue)

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/failure.py", line 39, in runTest
raise self.exc_val.with_traceback(self.tb)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/loader.py", line 418, in loadTestsFromName
addr.filename, addr.module)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 47, in importFromPath
return self.importFromDir(dir_path, fqname)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 94, in importFromDir
mod = load_module(part_fqname, fh, filename, desc)
File "/usr/lib/python3.4/imp.py", line 235, in load_module
return load_source(name, filename, file)
File "/usr/lib/python3.4/imp.py", line 171, in load_source
module = methods.load()
File "", line 1220, in load
File "", line 1200, in _load_unlocked
File "", line 1129, in _exec
File "", line 1471, in exec_module
File "", line 321, in _call_with_frames_removed
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/faidx_test.py", line 8, in
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: Failure: Error (Dependency error(s). Cannot continue)

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/failure.py", line 39, in runTest
raise self.exc_val.with_traceback(self.tb)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/loader.py", line 418, in loadTestsFromName
addr.filename, addr.module)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 47, in importFromPath
return self.importFromDir(dir_path, fqname)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 94, in importFromDir
mod = load_module(part_fqname, fh, filename, desc)
File "/usr/lib/python3.4/imp.py", line 235, in load_module
return load_source(name, filename, file)
File "/usr/lib/python3.4/imp.py", line 171, in load_source
module = methods.load()
File "", line 1220, in load
File "", line 1200, in _load_unlocked
File "", line 1129, in _exec
File "", line 1471, in exec_module
File "", line 321, in _call_with_frames_removed
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/mapping_test.py", line 10, in
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_write_info_file (ref_preparer_test.TestRefPreparer)

test _write_info_file

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/ref_preparer_test.py", line 109, in test_write_info_file
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

ERROR: test_cluster_with_cdhit (reference_data_test.TestReferenceData)

Test cluster_with_cd_hit

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/reference_data_test.py", line 557, in test_cluster_with_cdhit
got = refdata.cluster_with_cdhit(inprefix, outprefix)
File "/home/genetica/Documentos/Software/ariba-master/ariba/reference_data.py", line 486, in cluster_with_cdhit
new_clusters = cdhit_runner.run()
File "/home/genetica/Documentos/Software/ariba-master/ariba/cdhit.py", line 190, in run
common.syscall(cmd, verbose=self.verbose)
File "/home/genetica/Documentos/Software/ariba-master/ariba/common.py", line 22, in syscall
sys.exit(1)
nose.proxy.SystemExit: 1

ERROR: Failure: Error (Dependency error(s). Cannot continue)

Traceback (most recent call last):
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/failure.py", line 39, in runTest
raise self.exc_val.with_traceback(self.tb)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/loader.py", line 418, in loadTestsFromName
addr.filename, addr.module)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 47, in importFromPath
return self.importFromDir(dir_path, fqname)
File "/home/genetica/Documentos/Software/ariba-master/.eggs/nose-1.3.7-py3.4.egg/nose/importer.py", line 94, in importFromDir
mod = load_module(part_fqname, fh, filename, desc)
File "/usr/lib/python3.4/imp.py", line 235, in load_module
return load_source(name, filename, file)
File "/usr/lib/python3.4/imp.py", line 171, in load_source
module = methods.load()
File "", line 1220, in load
File "", line 1200, in _load_unlocked
File "", line 1129, in _exec
File "", line 1471, in exec_module
File "", line 321, in _call_with_frames_removed
File "/home/genetica/Documentos/Software/ariba-master/ariba/tests/samtools_variants_test.py", line 9, in
extern_progs = external_progs.ExternalProgs()
File "/home/genetica/Documentos/Software/ariba-master/ariba/external_progs.py", line 115, in init
raise Error('Dependency error(s). Cannot continue')
ariba.external_progs.Error: Dependency error(s). Cannot continue

Ran 219 tests in 3.644s

FAILED (errors=21)

When trying to build from sources using the tarball hosted in pypi I got this error:

error: file ....../scripts/vcfcall_ariba.cpython-33m.so' does not exist

I noticed that his issue was happening because the tarball in pypi has a broken link in scripts/vcfcall_ariba.cpython-33m.so

After downloading the tarball from github the installation worked fine.

Hi,
We have tried the VirulenceFinder database, but when we look at the output files the naming of the virulence genes seems to relate to "cluster numbers". Looking at individual files it seems like the first column contain the correct name of the virulence gene and the last column has a free text With the original name. Could it be possible to the change names for the files uploaded to phandango?

It seems that setting --threads to anything greater than 1 causes the following error:

Signal 15 received in cluster tolC... Stopping!
Process ForkPoolWorker-4:
Signal 15 received in cluster tolC... Stopping!
Process ForkPoolWorker-1:
Signal 15 received in cluster tolC... Stopping!
Process ForkPoolWorker-3:
Traceback (most recent call last):
Traceback (most recent call last):
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/multiprocessing/process.py", line 249, in _bootstrap
    self.run()
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/multiprocessing/process.py", line 249, in _bootstrap
    self.run()
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/multiprocessing/process.py", line 93, in run
    self._target(*self._args, **self._kwargs)
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/multiprocessing/process.py", line 93, in run
    self._target(*self._args, **self._kwargs)
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/cluster.py", line 154, in _receive_signal
    with open(self.fail_file, 'w') as f:
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/cluster.py", line 154, in _receive_signal
    with open(self.fail_file, 'w') as f:
Signal 15 received in cluster tolC... Stopping!
FileNotFoundError: [Errno 2] No such file or directory: '/home/schultzm/scripts/schultzm/development/results/2014-00065/ariba_CARD/.fails/tolC'
FileNotFoundError: [Errno 2] No such file or directory: '/home/schultzm/scripts/schultzm/development/results/2014-00065/ariba_CARD/.fails/tolC'

Thanks for a nice programme.
We have used Ariba With both Card and Resfinder database and it Works well.
Today I have also tested the virulencefinder db and get the following error Message (see below).
I've also run With resfinder today as well and it Works fine.
Do you have any idea what's going wrong? And if there is there anything you could do to help I would be very Grateful.
Best regards, Camilla

[E::hts_idx_push] Unsorted positions on sequence #1: 16 followed by 2
Traceback (most recent call last):
File "/work/projects/nn9305k/src/anaconda3/bin/ariba", line 298, in
args.func(args)
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/tasks/run.py", line 65, in run
c.run()
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/clusters.py", line 602, in run
self._run()
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/clusters.py", line 627, in _run
self._init_and_run_clusters()
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/clusters.py", line 424, in _init_and_run_clusters
reference_names=self.cluster_ids[cluster_name],
KeyError: ''

cc1 some warnings treated as erros
command gcc failed exit status 1

saying

third_party/fermi-lite-0.1/mag.c:246:2: error: ISO C90 forbids mixed declarations and code [-Werror=declaration-after-statement]

in relation to

ku128_v *r = &g->v.a[idd>>1].nei[idd&1];

So will try editing and:
ku128_v *r;
r = &g->v.a[idd>>1].nei[idd&1];

Appears C90 std is fussy with this . Is C90 stipulation necessary?

Hello,

I would like to use ariba without cd-hit clustering. When two similar reference sequences exist, I guess some sequence reads will be mapped to both of them (in other words, some reads will be mapped to two clusters). In such a case, how does ariba deal with these reads? Does ariba use these reads for local assemblies in both of these two clusters?

Some tests in Ariba 2.9.0 fail when using the latest Bowtie2 version (2.3.1):

======================================================================
FAIL: Test run_bowtie2 unsorted
----------------------------------------------------------------------
Traceback (most recent call last):
  File "/build/ariba-2.9.0+ds/ariba/tests/mapping_test.py", line 61, in test_run_bowtie2
    self.assertListEqual(expected, got)
AssertionError: Lists differ: [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTC[857 chars]AT')] != [('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCT[794 chars]AT')]

First differing element 0:
('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC')
('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT')

- [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC'),
-  ('1', 147, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT'),
? ^       ^^

+ [('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT'),
? ^       ^^

+  ('1', 69, None, 30, [], 'AGCCCTCCACAGGATGGTGGTATAC'),
-  ('2', 99, 'ref', 124, [(0, 25)], 'TAATGTTCTTAGGGCTTACCATAGA'),
?        ^^

+  ('2', 73, 'ref', 124, [(0, 25)], 'TAATGTTCTTAGGGCTTACCATAGA'),
?        ^^

-  ('2', 147, 'ref', 170, [(0, 20), (4, 5)], 'TCCACCTTAGCTAAGCGCAGACTCG'),
+  ('2', 133, None, 124, [], 'CGAGTCTGCGCTTAGCTAAGGTGGA'),
   ('3', 73, 'ref', 86, [(0, 25)], 'TCGGGTCTGTACAAGGACGGATGGT'),
   ('3', 133, None, 86, [], 'CGTACTGACTGACTGACGTACTGCA'),
   ('4', 99, 'ref', 55, [(0, 25)], 'CCGCCGGGAAGTCCTTCTGTCGTGC'),
   ('4', 147, 'ref', 136, [(0, 25)], 'GGCTTACCATAGAGGTACACTAAAA'),
-  ('5', 99, 'ref', 0, [(4, 2), (0, 23)], 'CCTCCACAGGATGGTGGTATACCTG'),
?        ^^  ^^ --  ^   ---------------

+  ('5', 77, None, -1, [], 'CCTCCACAGGATGGTGGTATACCTG'),
?        ^^  ^^^   ^^

-  ('5', 147, 'ref', 166, [(0, 24), (4, 1)], 'TTCATCCACCTTAGCTAAGCGCAGA'),
+  ('5', 141, None, -1, [], 'TCTGCGCTTAGCTAAGGTGGATGAA'),
   ('6', 77, None, -1, [], 'CAGTTGCATGACGTCATGCAGTCAT'),
   ('6', 141, None, -1, [], 'AATGAGTATGATGAGTAATGGTATG'),
   ('7', 99, 'ref', 56, [(4, 1), (0, 23), (4, 1)], 'ACGCCGGGAAGTCCTTCTGTCGTGT'),
   ('7', 147, 'ref', 136, [(0, 24), (4, 1)], 'GGCTTACCATAGAGGTACACTAAAT')]

======================================================================
FAIL: Test run_bowtie2 sorted
----------------------------------------------------------------------
Traceback (most recent call last):
  File "/build/ariba-2.9.0+ds/ariba/tests/mapping_test.py", line 102, in test_run_bowtie2_and_sort
    self.assertListEqual(expected, got)
AssertionError: Lists differ: [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTC[857 chars]TG')] != [('1', 69, None, 30, [], 'AGCCCTCCACAGGATGGTGGTA[794 chars]TG')]

First differing element 0:
('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC')
('1', 69, None, 30, [], 'AGCCCTCCACAGGATGGTGGTATAC')

Diff is 1432 characters long. Set self.maxDiff to None to see it.

----------------------------------------------------------------------

it looks like some results do not match the expected reference. It might have to do with the fact that in the latest version:

The default ---score-min for --local mode is now 'G,20,8'. That was the stated default in the documentation for a while, but the actual default was 'G,0,10' for many versions. Now the default matches the documentation and, we find, yields more accurate alignments than 'G,0,10'

It would be nice if the behaviour of Ariba when given various Bowtie2 versions could be made consistent as it currently causes the tests to fail, breaking builds. We have, for example, run into this issue on Debian since Debian's update to the latest Bowtie version.

Hi,
Couldn't upgrade on python3.4 due to infamous C90 no mixed declaration and code error coming out of mag.c line 246 (mag_eh_markdel func). My default gcc is 4.4.7 ... I'm fairly sure it's not hardwired for "-std=C90" though.
Cheers.

Hi! Running 2.9 here. Whenever I run something, I get this out:

self.mlst_profile_file /home/karinlag/PycharmProjects/testdata/fastq_files/mlst_db/ref_db/pubmlst.profile.txt
self.report_file_filtered /home/karinlag/PycharmProjects/testdata/fastq_files/Angen-bacDNA2-78-2013-01-4718_S29_L001/report.tsv

(of course changing with the input)

Is this supposed to happen....?

CARD downloads now bz2 instead of gz

Cheers!

Hi, I installed all dependences for ARIBA and all the softwares are added to the path, all test passed and it installed correctly without errors.
Later, I downloaded the databases: CARD, argannot, ResFinder and VFDB, following the example in Wiki:
ariba getref card out.card
ariba prepareref --ref_prefix out.card out.card.prepareref
ariba run out.card.prepareref reads1.fastq reads2.fastq out.run

Nevertheless when I did the run task, I saw that the report.all.tsv file had many (-) symbols and the report.tsv file is empty.

report.all.tsv

report.tsv

How can I solve that?, thank you.

Hi,

There appears to be an error in the code with a list index out of range.

ariba run --verbose --force CARD /mnt/seq/MDU/READS/ariba_bug_reads/ariba_bug_reads_R1.fastq.gz /mnt/seq/MDU/READS/ariba_bug_reads/ariba_bug_reads_R2.fastq.gz /home/schultzm/scripts/schultzm/development/results/ariba_bug_reads/ariba_CARD
Found reads file: /mnt/seq/MDU/READS/ariba_bug_reads/ariba_bug_reads_R1.fastq.gz
Found reads file: /mnt/seq/MDU/READS/ariba_bug_reads/ariba_bug_reads_R2.fastq.gz
ARIBA version: 2.6.1

External dependencies:
bowtie2	2.2.9	/home/linuxbrew/.linuxbrew/bin/bowtie2
cdhit	4.6	/home/linuxbrew/.linuxbrew/bin/cd-hit-est
nucmer	3.1	/home/linuxbrew/.linuxbrew/bin/nucmer

External dependencies OK: True

Python version:
3.5.2 (default, Nov  7 2016, 09:25:32) 
[GCC 5.3.0]

Python packages:
ariba	2.6.1	/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/__init__.py
dendropy	4.2.0	/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/dendropy/__init__.py
pyfastaq	3.14.0	/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/pyfastaq/__init__.py
pymummer	0.10.1	/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/pymummer/__init__.py
pysam	0.9.1.4	/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/pysam/__init__.py

Python packages OK: True

Everything looks OK: True
Temporary directory: /tmp/schultzm/ariba.tmp.8gwpiegs
______________________ Mapping reads to clustered genes _______________________
Finished mapping

_____________________________ Generating clusters _____________________________
syscall: sort -k1,1 -k 2,2n /home/schultzm/scripts/schultzm/development/results/ariba_bug_reads/ariba_CARD/minimap.reads > /home/schultzm/scripts/schultzm/development/results/ariba_bug_reads/ariba_CARD/read_store
Compressing file /home/schultzm/scripts/schultzm/development/results/ariba_bug_reads/ariba_CARD/read_store
Found 12066 proper read pairs from minimap
Total clusters to perform local assemblies: 69

Insert size information from reads mapped to reference genes:
Insert size:	285.0
Insert sspace sd:	0.79
Max insert:	561.5500000000001

___________________________ Assembling each cluster ___________________________
Will run 1 cluster(s) in parallel
Constructing cluster AAC_3__Ib (1 of 69)
Constructing cluster AAC_3__Ib_AAC_6___Ib__ (2 of 69)
Constructing cluster AAC_6___30_AAC_6___Ib__fusion_protein (3 of 69)
Constructing cluster AAC_6___31 (4 of 69)
Constructing cluster AAC_6___Ib+ (5 of 69)
Constructing cluster ANT_2____Ia (6 of 69)
Constructing cluster APH_3___Ia (7 of 69)
Constructing cluster CRP (8 of 69)
Constructing cluster Chlamydophila_psittaci_16S (9 of 69)
Constructing cluster Enterobacter_aerogenes_omp36 (10 of 69)
Constructing cluster Escherichia_coli_EF_Tu (11 of 69)
Constructing cluster Escherichia_coli_mutant (12 of 69)
Constructing cluster Escherichia_coli_mutant_1 (13 of 69)
Constructing cluster FosA5 (14 of 69)
Constructing cluster H_NS (15 of 69)
Constructing cluster Helicobacter_pylori_16S (16 of 69)
Constructing cluster KPC_- (17 of 69)
Constructing cluster Klebsiella_OmpK35_conferring (18 of 69)
Constructing cluster Klebsiella_OmpK36_conferring (19 of 69)
Constructing cluster Klebsiella_mutant_PhoP (20 of 69)
Constructing cluster LEN_1+ (21 of 69)
Constructing cluster Mrx (22 of 69)
Constructing cluster Mycobacterium_abscessus_16S+ (23 of 69)
Constructing cluster Neisseria_- (24 of 69)
Constructing cluster OKP_- (25 of 69)
Constructing cluster OXA_9 (26 of 69)
Constructing cluster Pasteurella_multocida_16S (27 of 69)
Constructing cluster Propionibacterium_acnes_16S (28 of 69)
Constructing cluster SHV_- (29 of 69)
Constructing cluster TEM_- (30 of 69)
Constructing cluster aadA- (31 of 69)
Constructing cluster aadA-_1 (32 of 69)
Constructing cluster aadA9 (33 of 69)
Constructing cluster acrA (34 of 69)
Constructing cluster acrA_1 (35 of 69)
Constructing cluster acrB (36 of 69)
Constructing cluster acrD (37 of 69)
Constructing cluster acrR (38 of 69)
Constructing cluster acrR_1 (39 of 69)
Constructing cluster alaS (40 of 69)
Constructing cluster arnA (41 of 69)
Constructing cluster cat+ (42 of 69)
Not constructing cluster dfrA- because it only has 2 reads (43 of 69)
Constructing cluster dfrA12 (44 of 69)
Constructing cluster emrB (45 of 69)
Constructing cluster fyuA (46 of 69)
Constructing cluster gyrA_6 (47 of 69)
Constructing cluster gyrA_7 (48 of 69)
Constructing cluster gyrB_1 (49 of 69)
Constructing cluster mdtA (50 of 69)
Not constructing cluster mdtB because it only has 2 reads (51 of 69)
Constructing cluster mdtC (52 of 69)
Constructing cluster mdtD (53 of 69)
Constructing cluster mphA (54 of 69)
Constructing cluster murA_12 (55 of 69)
Constructing cluster ompF (56 of 69)
Constructing cluster oqxA (57 of 69)
Constructing cluster oqxB (58 of 69)
Constructing cluster parC_2 (59 of 69)
Constructing cluster parC_3 (60 of 69)
Not constructing cluster parE_2 because it only has 2 reads (61 of 69)
Constructing cluster patA (62 of 69)
Constructing cluster ramR_1 (63 of 69)
Constructing cluster rpoB (64 of 69)
Constructing cluster rrsB+ (65 of 69)
Constructing cluster smeE (66 of 69)
Constructing cluster sul1 (67 of 69)
Constructing cluster tolC (68 of 69)
Constructing cluster vgaC (69 of 69)
Start running cluster AAC_3__Ib in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_3__Ib
Finished running cluster AAC_3__Ib in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_3__Ib
Deleting cluster dir /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_3__Ib
Start running cluster AAC_3__Ib_AAC_6___Ib__ in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_3__Ib_AAC_6___Ib__
Finished running cluster AAC_3__Ib_AAC_6___Ib__ in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_3__Ib_AAC_6___Ib__
Deleting cluster dir /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_3__Ib_AAC_6___Ib__
Start running cluster AAC_6___30_AAC_6___Ib__fusion_protein in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___30_AAC_6___Ib__fusion_protein
Finished running cluster AAC_6___30_AAC_6___Ib__fusion_protein in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___30_AAC_6___Ib__fusion_protein
Deleting cluster dir /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___30_AAC_6___Ib__fusion_protein
Start running cluster AAC_6___31 in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___31
Finished running cluster AAC_6___31 in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___31
Deleting cluster dir /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___31
Start running cluster AAC_6___Ib+ in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___Ib+
Error making report for cluster  AAC_6___Ib+ ... traceback:
Traceback (most recent call last):
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/cluster.py", line 425, in _run
    self.report_lines = report.report_lines(self)
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/report.py", line 375, in report_lines
    lines.extend(_report_lines_for_one_contig(cluster, contig_name, ref_cov_per_contig, contig_pymummer_variants))
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/report.py", line 332, in _report_lines_for_one_contig
    ref_nt = cluster.ref_sequence[ref_coord]
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/pyfastaq/sequences.py", line 424, in __getitem__
    return self.seq[index]
IndexError: string index out of range
Failed cluster: AAC_6___Ib+
Finished running cluster AAC_6___Ib+ in directory /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___Ib+
Deleting cluster dir /tmp/schultzm/ariba.tmp.8gwpiegs/AAC_6___Ib+
Other clusters failed. Will not start cluster ANT_2____Ia
Other clusters failed. Will not start cluster APH_3___Ia
Other clusters failed. Will not start cluster CRP
Other clusters failed. Will not start cluster Chlamydophila_psittaci_16S
Other clusters failed. Will not start cluster Enterobacter_aerogenes_omp36
Other clusters failed. Will not start cluster Escherichia_coli_EF_Tu
Other clusters failed. Will not start cluster Escherichia_coli_mutant
Other clusters failed. Will not start cluster Escherichia_coli_mutant_1
Other clusters failed. Will not start cluster FosA5
Other clusters failed. Will not start cluster H_NS
Other clusters failed. Will not start cluster Helicobacter_pylori_16S
Other clusters failed. Will not start cluster KPC_-
Other clusters failed. Will not start cluster Klebsiella_OmpK35_conferring
Other clusters failed. Will not start cluster Klebsiella_OmpK36_conferring
Other clusters failed. Will not start cluster Klebsiella_mutant_PhoP
Other clusters failed. Will not start cluster LEN_1+
Other clusters failed. Will not start cluster Mrx
Other clusters failed. Will not start cluster Mycobacterium_abscessus_16S+
Other clusters failed. Will not start cluster Neisseria_-
Other clusters failed. Will not start cluster OKP_-
Other clusters failed. Will not start cluster OXA_9
Other clusters failed. Will not start cluster Pasteurella_multocida_16S
Other clusters failed. Will not start cluster Propionibacterium_acnes_16S
Other clusters failed. Will not start cluster SHV_-
Other clusters failed. Will not start cluster TEM_-
Other clusters failed. Will not start cluster aadA-
Other clusters failed. Will not start cluster aadA-_1
Other clusters failed. Will not start cluster aadA9
Other clusters failed. Will not start cluster acrA
Other clusters failed. Will not start cluster acrA_1
Other clusters failed. Will not start cluster acrB
Other clusters failed. Will not start cluster acrD
Other clusters failed. Will not start cluster acrR
Other clusters failed. Will not start cluster acrR_1
Other clusters failed. Will not start cluster alaS
Other clusters failed. Will not start cluster arnA
Other clusters failed. Will not start cluster cat+
Other clusters failed. Will not start cluster dfrA12
Other clusters failed. Will not start cluster emrB
Other clusters failed. Will not start cluster fyuA
Other clusters failed. Will not start cluster gyrA_6
Other clusters failed. Will not start cluster gyrA_7
Other clusters failed. Will not start cluster gyrB_1
Other clusters failed. Will not start cluster mdtA
Other clusters failed. Will not start cluster mdtC
Other clusters failed. Will not start cluster mdtD
Other clusters failed. Will not start cluster mphA
Other clusters failed. Will not start cluster murA_12
Other clusters failed. Will not start cluster ompF
Other clusters failed. Will not start cluster oqxA
Other clusters failed. Will not start cluster oqxB
Other clusters failed. Will not start cluster parC_2
Other clusters failed. Will not start cluster parC_3
Other clusters failed. Will not start cluster patA
Other clusters failed. Will not start cluster ramR_1
Other clusters failed. Will not start cluster rpoB
Other clusters failed. Will not start cluster rrsB+
Other clusters failed. Will not start cluster smeE
Other clusters failed. Will not start cluster sul1
Other clusters failed. Will not start cluster tolC
Other clusters failed. Will not start cluster vgaC
Finished assembling clusters

Traceback (most recent call last):
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/clusters.py", line 546, in run
    self._run()
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/clusters.py", line 579, in _run
    raise Error('At least one cluster failed! Stopping...')
ariba.clusters.Error: At least one cluster failed! Stopping...

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/home/linuxbrew/.linuxbrew/bin/ariba", line 231, in <module>
    args.func(args)
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/tasks/run.py", line 63, in run
    c.run()
  File "/home/linuxbrew/.linuxbrew/opt/python3/lib/python3.5/site-packages/ariba/clusters.py", line 549, in run
    raise Error('Something went wrong during ariba run. Cannot continue. Error was:\n' + str(err))
ariba.clusters.Error: Something went wrong during ariba run. Cannot continue. Error was:
At least one cluster failed! Stopping...

Hello Ariba creators,

Thanks very much for writing this software.

I'm wondering if there is a way to create a custom database that includes different types of mutations rather than just SNPs? When I try to create a custom DB with indels the sanity checks in the aln2meta script don't like the formatting of the variant column of the tsv file. The SNP variants are okay but I can't figure out what format things like frameshifts (e.g. L295fs) or in-frame deletions (L294-D295del) should be?

Is Ariba capable of looking at these type of variants and I'm just missing something obvious?

Thanks for your time.

Regards,

Derek

for some of my antibiotic data I get the following error while running ariba micplot:
Traceback (most recent call last):
File "/usr/bin/ariba", line 292, in
args.func(args)
File "/usr/lib/python3/dist-packages/ariba/tasks/micplot.py", line 39, in run
plotter.run()
File "/usr/lib/python3/dist-packages/ariba/mic_plotter.py", line 651, in run
self._make_plot(mic_data, top_plot_data, all_mutations, combinations)
File "/usr/lib/python3/dist-packages/ariba/mic_plotter.py", line 553, in _make_plot
MicPlotter._pairwise_compare(violin_data, columns, self.outprefix + '.mannwhitney.tsv', self.p_cutoff, 'mannwhitneyu')
File "/usr/lib/python3/dist-packages/ariba/mic_plotter.py", line 520, in _pairwise_compare
statistic, pvalue = scipy.stats.mannwhitneyu(list1, list2, alternative='two-sided')
TypeError: mannwhitneyu() got an unexpected keyword argument 'alternative'

I am installing 2.9 on a cluster now (redhat).

I fail building wheel, and I get this as the error just before Failing building wheel for ariba:

Traceback (most recent call last):
File "", line 1, in
File "/tmp/pip-build-3radi493/ariba/setup.py", line 81, in
'License :: OSI Approved :: GNU General Public License v3 (GPLv3)',
File "/cluster/software/VERSIONS/python3-3.5.0/lib/python3.5/distutils/core.py", line 148, in setup
dist.run_commands()
File "/cluster/software/VERSIONS/python3-3.5.0/lib/python3.5/distutils/dist.py", line 955, in run_commands
self.run_command(cmd)
File "/cluster/software/VERSIONS/python3-3.5.0/lib/python3.5/distutils/dist.py", line 974, in run_command
cmd_obj.run()
File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/wheel/bdist_wheel.py", line 213, in run
archive_basename = self.get_archive_basename()
File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/wheel/bdist_wheel.py", line 161, in get_archive_basename
impl_tag, abi_tag, plat_tag = self.get_tag()
File "/work/projects/nn9305k/bin/virtenv/ariba/lib/python3.5/site-packages/wheel/bdist_wheel.py", line 155, in get_tag
assert tag == supported_tags[0]
AssertionError

What is this assertion that is failing?

I get the following when simply trying to figure out the ariba version:

(ariba) [karinlag@abel ~]$ ariba version
Traceback (most recent call last):
File "/work/projects/nn9305k/src/anaconda3/bin/ariba", line 292, in
args.func(args)
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/tasks/version.py", line 5, in run
extern_progs, report_lines = versions.get_all_versions(raise_error=False)
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/versions.py", line 21, in get_all_versions
extern_progs = external_progs.ExternalProgs(fail_on_error=False)
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/site-packages/ariba/external_progs.py", line 65, in init
if prog in min_versions and LooseVersion(version) < LooseVersion(min_versions[prog]):
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/distutils/version.py", line 52, in lt
c = self._cmp(other)
File "/work/projects/nn9305k/src/anaconda3/lib/python3.6/distutils/version.py", line 337, in _cmp
if self.version < other.version:
TypeError: '<' not supported between instances of 'str' and 'int'
(ariba) [karinlag@abel ~]$

Am I messing up something, or is this something with the code?

Pip installed ariba this morning, btw.

Hi!
I get this warning when I get the no 1 ecoli profile. Could you expand on what this really means?

(ariba)[karinlag@abel mlst]$ python3 /work/projects/nn9305k/bin/virtenv/ariba/bin/ariba pubmlstget "Escherichia coli#1" get_mlst1
WARNING: Same profile found twice in input file, but two different STs. Going to use the ST with the smaller number (7066)
... STs are 7066 7067 and alleles are adk:10, fumC:957, gyrB:4, icd:8, mdh:601, purA:8, recA:2
WARNING: Median sequence length is 469 but fumC.798 has length 382 which is too long or short. Removing

I just noticed minimap by default uses 3 threads.

You should check to ensure Ariba sets this back to the number of threads the user chose

Hi,
The mlst scheme I work on is not hosted at PUBMLST. How can I format it to run against with ariba?

We are having problems download the data from CGE (-finder databases)

ariba getref resfinder out.resfinder
Downloading data with:
curl -X POST --data "folder=resfinder&filename=resfinder.zip" -o resfinder.zip https://cge.cbs.dtu.dk/cge/download_data.php
The following command failed with exit code 127
curl -X POST --data "folder=resfinder&filename=resfinder.zip" -o resfinder.zip https://cge.cbs.dtu.dk/cge/download_data.php

The output was:

/bin/sh: 1: curl: not found

When I run this command docker run --rm -it -v $(pwd):/data/ sangerpathogens/ariba ariba pubmlstget "Staphylococcus aureus" get_mlst
The get_mlst was expected to be in the current directory I run the command but it was not, event when I replaced $(pwd) with an absolute path, i.e. /home/ubuntu/mlst:/data but It did not work either.

BUT....
If I logged in docker container with docker run --rm -it -v $(pwd):/data/ sangerpathogens/ariba and run ariba pubmlstget "Staphylococcus aureus" get_mlst , it worked, and get_mlst appeared on the host

Similarly to #170, we again see some differring test data with a newer version of Bowtie2:

======================================================================
FAIL: Test run_bowtie2 unsorted
----------------------------------------------------------------------
Traceback (most recent call last):
  File "/build/1st/ariba-2.10.0+ds/ariba/tests/mapping_test.py", line 62, in test_run_bowtie2
    self.assertListEqual(expected, got)
AssertionError: Lists differ: [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTC[857 chars]AT')] != [('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCT[795 chars]AT')]

First differing element 0:
('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC')
('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT')

- [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC'),
-  ('1', 147, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT'),
? ^       ^^

+ [('1', 153, 'ref', 30, [(0, 25)], 'AGGATACAGATCTTGTGGGAAAGGT'),
? ^       ^^

+  ('1', 101, None, 30, [], 'AGCCCTCCACAGGATGGTGGTATAC'),
-  ('2', 99, 'ref', 124, [(0, 25)], 'TAATGTTCTTAGGGCTTACCATAGA'),
?        ^^

+  ('2', 73, 'ref', 124, [(0, 25)], 'TAATGTTCTTAGGGCTTACCATAGA'),
?        ^^

-  ('2', 147, 'ref', 170, [(0, 20), (4, 5)], 'TCCACCTTAGCTAAGCGCAGACTCG'),
+  ('2', 133, None, 124, [], 'CGAGTCTGCGCTTAGCTAAGGTGGA'),
   ('3', 73, 'ref', 86, [(0, 25)], 'TCGGGTCTGTACAAGGACGGATGGT'),
   ('3', 133, None, 86, [], 'CGTACTGACTGACTGACGTACTGCA'),
   ('4', 99, 'ref', 55, [(0, 25)], 'CCGCCGGGAAGTCCTTCTGTCGTGC'),
   ('4', 147, 'ref', 136, [(0, 25)], 'GGCTTACCATAGAGGTACACTAAAA'),
-  ('5', 99, 'ref', 0, [(4, 2), (0, 23)], 'CCTCCACAGGATGGTGGTATACCTG'),
?        ^^  ^^ --  ^   ---------------

+  ('5', 77, None, -1, [], 'CCTCCACAGGATGGTGGTATACCTG'),
?        ^^  ^^^   ^^

-  ('5', 147, 'ref', 166, [(0, 24), (4, 1)], 'TTCATCCACCTTAGCTAAGCGCAGA'),
+  ('5', 141, None, -1, [], 'TCTGCGCTTAGCTAAGGTGGATGAA'),
   ('6', 77, None, -1, [], 'CAGTTGCATGACGTCATGCAGTCAT'),
   ('6', 141, None, -1, [], 'AATGAGTATGATGAGTAATGGTATG'),
   ('7', 99, 'ref', 56, [(4, 1), (0, 23), (4, 1)], 'ACGCCGGGAAGTCCTTCTGTCGTGT'),
   ('7', 147, 'ref', 136, [(0, 24), (4, 1)], 'GGCTTACCATAGAGGTACACTAAAT')]

======================================================================
FAIL: Test run_bowtie2 sorted
----------------------------------------------------------------------
Traceback (most recent call last):
  File "/build/1st/ariba-2.10.0+ds/ariba/tests/mapping_test.py", line 105, in test_run_bowtie2_and_sort
    self.assertListEqual(expected, got)
AssertionError: Lists differ: [('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTC[857 chars]TG')] != [('1', 101, None, 30, [], 'AGCCCTCCACAGGATGGTGGT[795 chars]TG')]

First differing element 0:
('1', 99, 'ref', 0, [(4, 5), (0, 20)], 'AGCCCTCCACAGGATGGTGGTATAC')
('1', 101, None, 30, [], 'AGCCCTCCACAGGATGGTGGTATAC')

Diff is 1434 characters long. Set self.maxDiff to None to see it.

----------------------------------------------------------------------
Ran 335 tests in 173.301s

Please also see https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=870362.

By default matplotlib uses an X window backend. micplot will therefore die if one isn't available. Can be fixed by adding this before any pyplot import

import matplotlib
matplotlib.use('Agg')

The card.donwload folder is left around.

Dear Martin,

Thank you so much again for explaining ARIBA
during the conference ABPHM2017 in Sanger in May.

I do think ARIBA is a really nice, well-designed,
generally useful tool.

I'm trying to detect presence or absence of a promoter
sequence carrying a deletion associated with AMR.

When I used the sequence carrying the deletion as a reference,
a report of ARIBA run for a sample without carrying the deletion is
http://yahara.hustle.ne.jp/projects/ariba/report.tsv
in which column T (ref_ctg_effect) is correctly indicated as "INS".

However, ARIBA summary for the report
http://yahara.hustle.ne.jp/projects/ariba/out.summary.csv
says "mtrR_Adel_promoter.match" is yes.

But this sample does not have the deletion, so I would like to
have a summary in which "mtrR_Adel_promoter.match" is no.

Of course I read definition of "match" judged by the summary command
https://github.com/sanger-pathogens/ariba/wiki/Task:-summary

Is ARIBA not designed to detect this kind of deletion?
I appreciate your comment.
Thanks a lot in advance.

Best wishes,

Koji

Koji Yahara
Senior Research Fellow
Antimicrobial Resistance Research Center
National Institute of Infectious Diseases
4-2-1 Aobacho, Higashimurayama, Tokyo
189-0002 Japan
Tel: +81-42-561-0771 (Ex. 3539)

Hi!

I'm using ariba on a cluster, where I have to activate various software explicitly.

I just installed the current version, and ran ariba test out to make sure everything is fine. However, I get plenty of warnings re spades missing. However, it doesn't say anywhere that it needs spades, and also it seems to say that things are fine anyhow. So, thus: does it actually want spades available on the command line?

I am trying to download card database but get this error:

Gettingavailable CARD versions
Downloading "https://card.mcmaster.ca/download" and saving as "download.html" ... done
Traceback (most recent call last):
File "/home/roham/anaconda3/bin/ariba", line 292, in
args.func(args)
File "/home/roham/anaconda3/lib/python3.6/site-packages/ariba/tasks/getref.py", line 11, in run
getter.run(options.outprefix)
File "/home/roham/anaconda3/lib/python3.6/site-packages/ariba/ref_genes_getter.py", line 483, in run
exec('self.get_from' + self.ref_db + '(outprefix)')
File "", line 1, in
File "/home/roham/anaconda3/lib/python3.6/site-packages/ariba/ref_genes_getter.py", line 77, in _get_from_card
versions = self._get_card_versions('download.html')
File "/home/roham/anaconda3/lib/python3.6/site-packages/ariba/ref_genes_getter.py", line 55, in _get_card_versions
raise Error('Error getting CARD versions. Cannot continue')
ariba.ref_genes_getter.Error: Error getting CARD versions. Cannot continue

Hello,

The document about the command flag describes the flag ref_seq_choose_fail as this is set to true if something went wrong when trying to find the closest reference sequence within a cluster. Could you please tell me what does something went wrong means? Does this indicate the case when the closest reference sequence does not belong to the cluster, which is described in the ARIBA paper?

Add the latest version of the srst2_argannot database (ARGannot_r2.fasta) to ariba getref.

https://github.com/katholt/srst2/blob/master/data/ARGannot_r2.fasta

ARIBA is pointing to an archived copy of the PlasmidFinder databases. The current ones are at:

https://bitbucket.org/genomicepidemiology/plasmidfinder_db/raw/master/enterobacteriaceae.fsa
https://bitbucket.org/genomicepidemiology/plasmidfinder_db/raw/master/gram_positive.fsa

Hey,
Thanks for developing ariba,
I am using ariba for MLST calling. My scheme is not available online so I've created a custom scheme (issue #185 ). I am interested to get the sequences of each locus from all strains for further alignment and phylogeny.
These sequences should be in the file (assembled_seqs.fa).
My issue is:
Some of the sequences are shorter than the reference (2-6 nucleotide short). Also the file (assembled_genes.fa) in all of my strains is empty.
I used the option '--gene_nt_extend' at 1000 but no improvement.
I would appreciate telling how I can fix that to get the full lengths as in reference

Thanks a lot,
MA