tseemann / berokka Goto Github PK

View Code? Open in Web Editor NEW

25.0 25.0 3.0 3.6 MB

🍊 💫 Trim, circularise and orient long read bacterial genome assemblies

License: GNU General Public License v3.0

Perl 96.86% Makefile 3.14%

bioinformatics circular-genome genome-assembly genomics long-read-sequencing

berokka's People

Contributors

Stargazers

Watchers

Forkers

wenchaolin gunzivan28 sumsarium

berokka's Issues

Filter out pacbio control sequence

https://www.ncbi.nlm.nih.gov/nucleotide/MG551957?report=genbank

LOCUS       MG551957                4034 bp    DNA     linear   SYN 21-NOV-2017
DEFINITION  Synthetic construct PacBio unrolled DNA internal control sequence.

Remove bad Canu contigs eg. covStat<=0 or reads=1

>tig00008674 len=10963 reads=1 covStat=0.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no

Add 'circular=true' to successfull trimmages

For use in https://github.com/rrwick/Rebaler by @rrwick

Add check to ensure --readlen is < contig length

Make results.tab right justified?

Enhancement suggestion to make table numbers right justified.

Removing files messages should be --debug only

Removing temporary files: 1.fa 1.head.fa 1.bls
Removing temporary files: 2.fa 2.head.fa 2.bls
Removing temporary files: 3.fa 3.head.fa 3.bls
Removing temporary files: 4.fa 4.head.fa 4.bls

Error on undefined value

Can't call method "start" on an undefined value at /home/tseemann/git/berokka/bin/berokka line 134, line 123.

Orient and rotate mitochondrial genome

I have an animal mitochondrial genome assembled by Unicycler (so no overlap). I'd like to orient and rotate the genome to agree with its closest relative in Genbank. I have a FASTA file of the related genome. Is this task possible with Berokka?

Berokka conda installer is broken?

Just reporting the conda installer for berokka has a Perl issue.

conda create -n berokka_env berokka
conda activate berokka_env
berokka
Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module)

Small contigs cause reverse blast hit results and trim fail

Usually the beginning hits the end, which we handle:

Running: blastn -query 4.head.fa -subject 4.fa -out 4.bls -evalue 1E-6 -dust no
blastn: 1..13766/20000 aligns to 43298..57075/57075
tig00000003 keep 1..43297/57075 (remove 13779 bp)

On these smaller ones, the end hits the beginning, which we DO NOT HANDLE.

*** [7] tig00000006 ***
Using first 900 bp to BLAST
Writing tig00000006 ( 900 bp ) to 7.fa
Writing tig00000006 ( 900 bp ) to 7.head.fa
Running: blastn -query 7.head.fa -subject 7.fa -out 7.bls -evalue 1E-6 -dust no
blastn: 781..900/900 aligns to 1..120/900
tig00000006 - COULD NOT TRIM

ctl.bls files not deleted

1.ctl.bls       2.ctl.bls       3.ctl.bls       4.ctl.bls

berokka conda install has an issue with the Bio::SeqIO perl module

My conda install produces the following error:

berokka Can't locate Bio/SeqIO.pm in @INC (you may need to install the Bio::SeqIO module) (@INC contains: /home/kvandelannoo/miniconda3/envs/berokka_env/lib/site_perl/5.26.2/x86_64-linux-thread-multi /home/kvandelannoo/miniconda3/envs/berokka_env/lib/site_perl/5.26.2 /home/kvandelannoo/miniconda3/envs/berokka_env/lib/5.26.2/x86_64-linux-thread-multi /home/kvandelannoo/miniconda3/envs/berokka_env/lib/5.26.2 .) at /home/kvandelannoo/miniconda3/envs/berokka_env/bin/berokka line 4. BEGIN failed--compilation aborted at /home/kvandelannoo/miniconda3/envs/berokka_env/bin/berokka line 4.

I installed berokka using:
conda install -c conda-forge -c bioconda -c defaults berokka

I tried the following things without success:
1/ updating conda
2/ creating a separate conda env

My install looks OK to me:

which berokka
~/miniconda3/envs/berokka_env/bin/berokka

which perl
~/miniconda3/envs/berokka_env/bin/perl

echo $PATH | tr ":" "\n" | nl
 1  /home/kvandelannoo/miniconda3/envs/berokka_env/bin
     2  /home/kvandelannoo/miniconda3/condabin
     3  /usr/local/showq/0.15/bin
     4  /usr/local/slurm/latest/bin
     5  /usr/lib64/qt-3.3/bin
     6  /usr/local/bin
     7  /usr/bin
     8  /usr/local/sbin
     9  /usr/sbin
    10  /opt/ibutils/bin
    11  /opt/puppetlabs/bin
    12  /opt/dell/srvadmin/bin
    13  /home/kvandelannoo/.local/bin
    14  /home/kvandelannoo/bin

 perl -e "print qq(@INC)"
/home/kvandelannoo/miniconda3/envs/berokka_env/lib/site_perl/5.26.2/x86_64-linux-thread-multi /home/kvandelannoo/miniconda3/envs/berokka_env/lib/site_perl/5.26.2 /home/kvandelannoo/miniconda3/envs/berokka_env/lib/5.26.2/x86_64-linux-thread-multi /home/kvandelannoo/miniconda3/envs/berokka_env/lib/5.26.2

Any help with this would be much appreciated.

check_deps() should check db/ too

Make sure our control and dnaA data is present.

Brew install doesn't exist

Add to brewsci/bio

--outdir '.' and --force don't mix

Possibly dangerous!

For --keepfiles use FASTAID.suffix ?

Currently uses 1 .. N which is cleanand will always work, but names might be better.

Accidently trims whole sequence from 3967 bp => 0 bp

S.Enteriditis__2017-15455

#sequence       old_len new_len trimmed
tig00000001     4736005 4736005 0
tig00002852     3967    0       3968

Add some base errors to the last test.fna sequence overhang

just some SNPS
maybe an indel?

Doesn't quite align to end and circ fails

tig00000001     dna     4736005

 Score = 55308 bits (29950),  Expect = 0.0
 Identities = 29995/30013 (99%), Gaps = 17/30013 (0%)
 Strand=Plus/Plus

Query  1        CGCTGTCGGCAAGAATATAGCGGCTTGATGCCAAAG-CGCCT-GGTCATTTCGACAAAAA  58
                |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||
Sbjct  4704147  CGCTGTCGGCAAGAATATAGCGGCTTGATGCCAAAGGCGCCTGGGTCATTTCGACAAAAA  4704206

<snip>

Query  29988    ACGGTTTTTCAGT  30000
                |||||||||||||
Sbjct  4734143  ACGGTTTTTCAGT  4734155

Output unchanged despite clear overlaps

Hello,

Thank you for this tool. I tried to run it with a bacterial genome and it returned the same input sequence despite having clear overlaps at the beginning and end. It did not output any error. Do you know what could be the problem?

Thanks

Add --test option to help everyone

Good for travis too

MSG: trunc start,end -- there was no end for 1

*** [5] tig00003742 ***
Using first 3959 bp to BLAST
Writing tig00003742 ( 3959 bp ) to 5.fa
Writing tig00003742 ( 3959 bp ) to 5.head.fa
Running: blastn -query 5.head.fa -subject 5.fa -out 5.bls -evalue 1E-6 -dust no
blastn: 2..3959/3959 aligns to 2..3959/3959 at 98.5 %id
tig00003742 keep 1..0/3959 (remove 3960 bp)

------------- EXCEPTION -------------
MSG: trunc start,end -- there was no end for 1
STACK Bio::PrimarySeqI::trunc /home/linuxbrew/.linuxbrew/Cellar/perl/5.26.1_1/lib/perl5/site_perl/5.26.1/Bio/PrimarySeqI.pm:447
STACK main::check_overhang /home/tseemann/git/berokka/bin/berokka:149
STACK toplevel /home/tseemann/git/berokka/bin/berokka:74
-------------------------------------

Add --check option to check deps

Ensure we are good to go!

This should return the opposite

$ ! berokka --doesnotexist
Unknown option: doesnotexist
SYNOPSIS
  Filter, trim, circularise & orient long read assemblies
USAGE
  berokka [options] canu.contigs.fasta [another.fasta ...]
OPTIONS
  --help          This help.
  --debug         Debug info (default '0').
  --version       Print version and exit.
  --check         Check dependencies and exit.
  --test          Run a small test and exit.
  --force         Force overwite of existing (default '0').
  --outdir [X]    Output folder (default '').
  --readlen [N]   Approximate read length (default '30000').
  --keepfiles     Keep intermediate files (default '0').
  --noanno        Don't annotate FASTA with circular=true (default '0').
AUTHOR
  Torsten Seemann | https://github.com/tseemann/berokka
The command "! berokka --doesnotexist" exited with 1.

--help returns 1 not 0

Also check stderr/stdout

Error: NCBI C++ Exception:

hello，
I used conda to install berokka, but run into this problem:

Error: NCBI C++ Exception:
T0 "/opt/conda/conda-bld/blast_1537407096784/work/c++/src/objtools/readers/fasta.cpp", line 2178: Error: ncbi::objects::CFastaReader::PostWarning() - CFastaReader: Near line 7, there's a line that doesn't look like plausible data, but it's not marked as defline or comment. (m_Pos = 7

Thanks!!!!

Add orientation to origin support

Get file from circlator?