ugeneunipro / ugene Goto Github PK
View Code? Open in Web Editor NEWUGENE is free open-source cross-platform bioinformatics software
Home Page: http://ugene.net
License: GNU General Public License v2.0
UGENE is free open-source cross-platform bioinformatics software
Home Page: http://ugene.net
License: GNU General Public License v2.0
only the following files installed in the PREFIX:
LICENSE.txt LICENSE.3rd_party.txt application-x-ugene.xml application-x-ugene-ext.png data plugins transl_ru.qm transl_tr.qm ugene ugene.desktop ugene.png ugene.xpm ugene.1.gz
In the last working build (PKGBUILD not changed), the following files were installed in the PREFIX:
LICENSE.txt application-x-ugene-ext.png libU2Algorithm.so libU2Formats.so libU2Private.so libU2View.so libsamtools.a plugins_checker ugene ugene.xpm ugeneui LICENSE.3rd_party.txt data libU2Core.so libU2Gui.so libU2Script.so libbreakpad.so libugenedb.so transl_ru.qm ugene.desktop ugenecl ugene.1.gz application-x-ugene.xml libQSpec.so libU2Designer.so libU2Lang.so libU2Test.so libqscore.a plugins transl_tr.qm ugene.png ugenem
Добрый день! Честно говоря я не часто бываю на github по этому напишу в эту ветку. У меня есть желание поучаствовать в разработке UGENE, но я не очень понимаю с какой стороны к этому лучше подойти, вот. И я подумал что можно былобы исправить баг с установкой ярлыка UGENE в меню ubuntu и linux mint, вот. И я написал bash скрипт который установливает ярлык UGENE в linux меню. Возможно он вам будет интересен. Этот скрипт должен размещатся в той же директории где находится файл ./ugene и запускается из под sudo . Я его проверил на нескольких сборках ubuntu и linux mint , вроде бы всё хорошо работает. Cсылка на скрипт https://yadi.sk/d/LVRfnHNum-s6hQ
On armv7 the error is:
src/SendReportDialog.cpp:435:20: error: invalid output constraint '=a' in asm
: "=a"(regs[0]), "=b"(regs[1]), "=c"(regs[2]), "=d"(regs[3])
^
1 error generated.
If assembly is only for x86/x86_64 please place the check for architecture into cmake scripts.
Hi, I'd like to use QSpec in my project, looks very promising. However, my program is a fork of GPLv3 licensed code, and unfortunately FSF states that GPLv3/LGPLv3 and "GPLv2 only" are incompatible. I was unable to find "or later" part in project documentation. It might be I've missed something.
Some details:
UGENE Version: 37.0 64-bit (Dec 14 2020)
Operating System: OpenSUSE Tumbleweed
Linux Kernel: 5.9.12-1-default
I have a local blastp database I assembled from a series of .faa files with UGENE. I can succesfully search the database with an amino acid sequence, and get ~30 results for this sequence, which is the expected behavior. However, I run into problems when I try to fetch the corresponding sequences from the blastp search results.
Specifically, running this query:
gnl|BL_ORD_ID|135715
Results in the following behavior:
[ERROR][08:35] Task {Run NCBI BlastDBCmd task} finished with error: Subtask {BlastDBCmd tool} is failed: BlastDBCmd tool exited with code 1
Manual examination of the UGENE log file shows this:
Task {Run NCBI BlastDBCmd task} finished with error: Subtask {BlastDBCmd tool} is failed: BlastDBCmd tool exited with code 1
Unregistering task: Run NCBI BlastDBCmd task
Deleting task: BlastDBCmd tool
Deleting task: Read document: 'gnl_BL_ORD_ID_135715.fa'
Deleting task: Adding document to project: /home/colin/Documents/Work/Biochemistry/Projects/CARF/SsCsa3a/Bioinformatics/Seaches/gnl_BL_ORD_ID_135715.fa
AppMemory: 897Mb; Locked memory AppResource: 160/15842; SQLite memory 1Mb, max 1Mb
Deleting task: Opening view for document: /home/colin/Documents/Work/Biochemistry/Projects/CARF/SsCsa3a/Bioinformatics/Seaches/gnl_BL_ORD_ID_135715.fa
Deleting task: Run NCBI BlastDBCmd task
mouse_press Left_button 1613 944 CLASS_NAME: U2::Notification TEXT: [08:35:38] 'Run NCBI BlastDBCmd task' task failed: Subtask {BlastDBCm…
The blastp version is the one distributed with UGENE 37.0. Is there any way to get more descriptive logs of what part of the query is failing? The user running the UGENE process has proper write permissions for the file, and the database is searchable in the .psq file that UGENE created when the database was made. Failure occurs when attempting to fetch sequences only.
The breakpad update broke some architectures (e.g. i586), as it removed some compat code. (e.g. it always uses the mmap2 syscall instead of the older mmap).
Please pull a newer lss into the repo.
Assembly of a genome with use of Bowtie2 leads to a mistake.
[13:59:34] 'Dna assembly task' задача завершилась неудачно: Подзадача {DnaAssemblyMultiTask} завершена с ошибкой: Подзадача {Align short reads} завершена с ошибкой: Подзадача {Bowtie2 reads assembly} завершена с ошибкой: Подзадача {Bowtie 2 aligner tool} завершена с ошибкой: Error: Out of memory allocating 536870934 __m128i's for DP matrix: 'std::bad_alloc'
I'd like to set a reference for the sam/bam alignment in one go, as for example in IGV.
Currently, it's only possible to add a reference to each contig view individually, and when using a multifasta reference (which is always the case with genomes), only the first sequence is added (silently). In case of 100+ (1000+) contigs, manual setting of references is not possible.
When using primer3 plugin to design primers, the all the GC contents of reverse primers is wrong, while the forward primers are alright. Maybe it's a bug in version 1.27 and 1.28, windows 10.
This package cannot be built on Debian 11. Among other things, Werror-* keeps causing failures. It's the compiler's fault. GCC version = 10.2.1.
Compiler finally has segfault while compiling GTTestsRegressionScenarios_6001_7000.h:71:28. So, there's a problem. Debian 11 repos only contain version 38 of Ugene, which is why I'm trying to build 42.
Is there a way to switch to clang or some other way to get this to build?
INCLUDEPATH+=/usr/include/qt5 shouldn't be in the .pri file because it causes a build problem with non-system Qt version(conflict include files).
if it does not affect the build of the project, it is best to apply the next patch:
diff --git a/src/ugene_globals.pri b/src/ugene_globals.pri
index 74dd518..9d41b5a 100644
--- a/src/ugene_globals.pri
+++ b/src/ugene_globals.pri
@@ -8,8 +8,8 @@ DEFINES+=UGENE_VER_MAJOR=$${UGENE_VER_MAJOR}
DEFINES+=UGENE_VER_MINOR=$${UGENE_VER_MINOR}
DEFINES+=UGENE_VER_PATCH=$${UGENE_VER_PATCH}
-unix : !macx : INCLUDEPATH-=/usr/include
-unix : !macx : INCLUDEPATH+=/usr/include/qt5 /usr/include
+#unix : !macx : INCLUDEPATH-=/usr/include
+#unix : !macx : INCLUDEPATH+=/usr/include/qt5 /usr/include
#unix : !macx : INCLUDEPATH =/usr/include/qt5 $$INCLUDEPATH
# NGS package
INCLUDEPATH+=/usr/include/qt5 не должно быть в .pri файлах. Это вызывает проблемы при сборке с не системной версией Qt(возникает конфликт заголовочных файлов).
Если патч написанный выше никак не влияет на сборку проекта, то лучше его применить. qmake/cmake достаточно умный, чтобы самостоятельно добавить эти пути.
Hi,
where is ugene looking for the plasmid files? I don't see any. Please make this configurable in the Settings too. Users would hence laso know where they are stored.
The logfile should have recognized this as well.
/usr
/usr/bin
/usr/bin/ugene
/usr/lib
/usr/lib/ugene
/usr/lib/ugene/libQSpec.so
/usr/lib/ugene/libU2Algorithm.so
/usr/lib/ugene/libU2Core.so
/usr/lib/ugene/libU2Designer.so
/usr/lib/ugene/libU2Formats.so
/usr/lib/ugene/libU2Gui.so
/usr/lib/ugene/libU2Lang.so
/usr/lib/ugene/libU2Private.so
/usr/lib/ugene/libU2Script.so
/usr/lib/ugene/libU2Test.so
/usr/lib/ugene/libU2View.so
/usr/lib/ugene/libbreakpad.so
/usr/lib/ugene/libugenedb.so
/usr/lib/ugene/plugins
/usr/lib/ugene/plugins/libCoreTests.so
/usr/lib/ugene/plugins/libGUITestBase.so
/usr/lib/ugene/plugins/libannotator.so
/usr/lib/ugene/plugins/libapi_tests.so
/usr/lib/ugene/plugins/libball.so
/usr/lib/ugene/plugins/libbiostruct3d_view.so
/usr/lib/ugene/plugins/libchroma_view.so
/usr/lib/ugene/plugins/libcircular_view.so
/usr/lib/ugene/plugins/libclark_support.so
/usr/lib/ugene/plugins/libdbi_bam.so
/usr/lib/ugene/plugins/libdiamond_support.so
/usr/lib/ugene/plugins/libdna_export.so
/usr/lib/ugene/plugins/libdna_flexibility.so
/usr/lib/ugene/plugins/libdna_graphpack.so
/usr/lib/ugene/plugins/libdna_stat.so
/usr/lib/ugene/plugins/libdotplot.so
/usr/lib/ugene/plugins/libenzymes.so
/usr/lib/ugene/plugins/libexternal_tool_support.so
/usr/lib/ugene/plugins/libgenome_aligner.so
/usr/lib/ugene/plugins/libgor4.so
/usr/lib/ugene/plugins/libhmm2.so
/usr/lib/ugene/plugins/libkalign.so
/usr/lib/ugene/plugins/libkraken_support.so
/usr/lib/ugene/plugins/liblinkdata_support.so
/usr/lib/ugene/plugins/libmetaphlan2_support.so
/usr/lib/ugene/plugins/libngs_reads_classification.so
/usr/lib/ugene/plugins/libopencl_support.so
/usr/lib/ugene/plugins/liborf_marker.so
/usr/lib/ugene/plugins/libpcr.so
/usr/lib/ugene/plugins/libperf_monitor.so
/usr/lib/ugene/plugins/libphylip.so
/usr/lib/ugene/plugins/libprimer3.so
/usr/lib/ugene/plugins/libpsipred.so
/usr/lib/ugene/plugins/libptools.so
/usr/lib/ugene/plugins/libquery_designer.so
/usr/lib/ugene/plugins/libremote_blast.so
/usr/lib/ugene/plugins/librepeat_finder.so
/usr/lib/ugene/plugins/libsitecon.so
/usr/lib/ugene/plugins/libsmith_waterman.so
/usr/lib/ugene/plugins/libtest_runner.so
/usr/lib/ugene/plugins/libumuscle.so
/usr/lib/ugene/plugins/libvariants.so
/usr/lib/ugene/plugins/libweight_matrix.so
/usr/lib/ugene/plugins/libwevote_support.so
/usr/lib/ugene/plugins/libworkflow_designer.so
/usr/lib/ugene/plugins_checker
/usr/lib/ugene/transl_en.qm
/usr/lib/ugene/transl_ru.qm
/usr/lib/ugene/ugene
/usr/lib/ugene/ugenecl
/usr/lib/ugene/ugenem
/usr/lib/ugene/ugeneui
/usr/share
/usr/share/applications
/usr/share/applications/ugene.desktop
/usr/share/doc
/usr/share/doc/ugene-37.0-r1
/usr/share/doc/ugene-37.0-r1/README.md.bz2
/usr/share/icons
/usr/share/icons/hicolor
/usr/share/icons/hicolor/32x32
/usr/share/icons/hicolor/32x32/mimetypes
/usr/share/icons/hicolor/32x32/mimetypes/application-x-ugene-ext.png
/usr/share/man
/usr/share/man/man1
/usr/share/man/man1/ugene.1.bz2
/usr/share/mime
/usr/share/mime/packages
/usr/share/mime/packages/application-x-ugene.xml
/usr/share/pixmaps
/usr/share/pixmaps/ugene.png
/usr/share/pixmaps/ugene.xpm
/usr/share/ugene
/usr/share/ugene/data
/usr/share/ugene/data/DBXRefRegistry.txt
/usr/share/ugene/data/adapters
/usr/share/ugene/data/adapters/adapters.fasta
/usr/share/ugene/data/adapters/illumina
/usr/share/ugene/data/adapters/illumina/NexteraPE-PE.fa
/usr/share/ugene/data/adapters/illumina/TruSeq2-PE.fa
/usr/share/ugene/data/adapters/illumina/TruSeq2-SE.fa
/usr/share/ugene/data/adapters/illumina/TruSeq3-PE-2.fa
/usr/share/ugene/data/adapters/illumina/TruSeq3-PE.fa
/usr/share/ugene/data/adapters/illumina/TruSeq3-SE.fa
/usr/share/ugene/data/back_translation
/usr/share/ugene/data/back_translation/Bacteria
/usr/share/ugene/data/back_translation/Bacteria/Arthrobacter_aurescens_TC1.cut
/usr/share/ugene/data/back_translation/Bacteria/Bacillus_subtilis.cut
/usr/share/ugene/data/back_translation/Bacteria/Escherichia_coli.cut
/usr/share/ugene/data/back_translation/Bacteria/Haemophilus_influenzae.cut
/usr/share/ugene/data/back_translation/Bacteria/Helicobacter_pylori.cut
/usr/share/ugene/data/back_translation/Bacteria/Listeria_monocytogenes.cut
/usr/share/ugene/data/back_translation/Bacteria/Neisseria_meningitidis.cut
/usr/share/ugene/data/back_translation/Bacteria/Salmonella_typhimurium_LT2.cut
/usr/share/ugene/data/back_translation/Bacteria/Streptomyces_coelicolor_A3(2).cut
/usr/share/ugene/data/back_translation/Bacteria/Sulfolobus_solfataricus_P2.cut
/usr/share/ugene/data/back_translation/Invertebrates
/usr/share/ugene/data/back_translation/Invertebrates/Apis_mellifera_(honey_bee).cut
/usr/share/ugene/data/back_translation/Invertebrates/Caenorhabditis_elegans.cut
/usr/share/ugene/data/back_translation/Invertebrates/Drosophila_melanogaster_(fruit_fly).cut
/usr/share/ugene/data/back_translation/Invertebrates/Plasmodium_falciparum_(malaria_parasite_P._falciparum).cut
/usr/share/ugene/data/back_translation/Invertebrates/mitochondrion_Caenorhabditis_elegans.cut
/usr/share/ugene/data/back_translation/Invertebrates/mitochondrion_Drosophila_melanogaster_(fruit_fly).cut
/usr/share/ugene/data/back_translation/Mammalia
/usr/share/ugene/data/back_translation/Mammalia/Bos_taurus_(cow).cut
/usr/share/ugene/data/back_translation/Mammalia/Canis_familiaris_(dog).cut
/usr/share/ugene/data/back_translation/Mammalia/Sus_scrofa_(pig).cut
/usr/share/ugene/data/back_translation/Mammalia/mitochondrion_Bos_taurus_(cow).cut
/usr/share/ugene/data/back_translation/Mammalia/mitochondrion_Sus_scrofa_(pig).cut
/usr/share/ugene/data/back_translation/Plants
/usr/share/ugene/data/back_translation/Plants/Arabidopsis_thaliana_(thale_cress).cut
/usr/share/ugene/data/back_translation/Plants/Oryza_sativa.cut
/usr/share/ugene/data/back_translation/Plants/Zea_mays.cut
/usr/share/ugene/data/back_translation/Primates
/usr/share/ugene/data/back_translation/Primates/Homo_sapiens_(human).cut
/usr/share/ugene/data/back_translation/Primates/Pan_troglodytes_(chimpanzee).cut
/usr/share/ugene/data/back_translation/Primates/mitochondrion_Homo_sapiens_(human).cut
/usr/share/ugene/data/back_translation/Primates/mitochondrion_Pan_troglodytes_(chimpanzee).cut
/usr/share/ugene/data/back_translation/Rodents
/usr/share/ugene/data/back_translation/Rodents/Mus_musculus_(house_mouse).cut
/usr/share/ugene/data/back_translation/Rodents/Rattus_norvegicus_(Norway_rat).cut
/usr/share/ugene/data/back_translation/Vertebrates
/usr/share/ugene/data/back_translation/Vertebrates/Gallus_gallus_(chicken).cut
/usr/share/ugene/data/back_translation/Vertebrates/Takifugu_rubripes_(Fugu_rubripes).cut
/usr/share/ugene/data/back_translation/Vertebrates/Xenopus_laevis_(African_clawed_frog).cut
/usr/share/ugene/data/back_translation/Vertebrates/mitochondrion_Gallus_gallus_(chicken).cut
/usr/share/ugene/data/back_translation/Vertebrates/mitochondrion_Takifugu_rubripes_(Fugu_rubripes).cut
/usr/share/ugene/data/back_translation/Viruses
/usr/share/ugene/data/back_translation/Viruses/Human_immunodeficiency_virus_1_(HIV-1).cut
/usr/share/ugene/data/back_translation/Viruses/Influenza_A_virus.cut
/usr/share/ugene/data/back_translation/Yeast
/usr/share/ugene/data/back_translation/Yeast/Saccharomyces_cerevisiae_(baker's_yeast).cut
/usr/share/ugene/data/back_translation/tables.xml
/usr/share/ugene/data/biostruct3d_plugin
/usr/share/ugene/data/biostruct3d_plugin/BioStruct3DLinks.txt
/usr/share/ugene/data/cmdline
/usr/share/ugene/data/cmdline/align-clustalo.uwl
/usr/share/ugene/data/cmdline/align-clustalw.uwl
/usr/share/ugene/data/cmdline/align-kalign.uwl
/usr/share/ugene/data/cmdline/align-mafft.uwl
/usr/share/ugene/data/cmdline/align-tcoffee.uwl
/usr/share/ugene/data/cmdline/align-to-reference.uwl
/usr/share/ugene/data/cmdline/align.uwl
/usr/share/ugene/data/cmdline/convert-msa.uwl
/usr/share/ugene/data/cmdline/convert-seq.uwl
/usr/share/ugene/data/cmdline/extract-sequence.uwl
/usr/share/ugene/data/cmdline/extract_consensus_sequence.uwl
/usr/share/ugene/data/cmdline/extract_consensus_string.uwl
/usr/share/ugene/data/cmdline/extract_coverage.uwl
/usr/share/ugene/data/cmdline/fetch-sequence.uwl
/usr/share/ugene/data/cmdline/find-orfs.uwl
/usr/share/ugene/data/cmdline/find-repeats.uwl
/usr/share/ugene/data/cmdline/find-sw.uwl
/usr/share/ugene/data/cmdline/gene-by-gene.uwl
/usr/share/ugene/data/cmdline/generate-dna.uwl
/usr/share/ugene/data/cmdline/hmm2-build.uwl
/usr/share/ugene/data/cmdline/hmm2-search.uwl
/usr/share/ugene/data/cmdline/hmm3-build-and-search.uwl
/usr/share/ugene/data/cmdline/join-quality.uwl
/usr/share/ugene/data/cmdline/local-blast+.uwl
/usr/share/ugene/data/cmdline/pfm-build.uwl
/usr/share/ugene/data/cmdline/pfm-search.uwl
/usr/share/ugene/data/cmdline/pwm-build.uwl
/usr/share/ugene/data/cmdline/pwm-search.uwl
/usr/share/ugene/data/cmdline/query.uwl
/usr/share/ugene/data/cmdline/remote-request.uwl
/usr/share/ugene/data/cmdline/revcompl.uwl
/usr/share/ugene/data/cmdline/sitecon-build.uwl
/usr/share/ugene/data/cmdline/sitecon-search.uwl
/usr/share/ugene/data/cmdline/snp.uwl
/usr/share/ugene/data/custom_annotations
/usr/share/ugene/data/custom_annotations/plasmid_features.txt
/usr/share/ugene/data/enzymes
/usr/share/ugene/data/enzymes/2013_08_01.bairoch.gz
/usr/share/ugene/data/genome_lengths
/usr/share/ugene/data/genome_lengths/danRer7.genome
/usr/share/ugene/data/genome_lengths/ecoli.genome
/usr/share/ugene/data/genome_lengths/hg18.genome
/usr/share/ugene/data/genome_lengths/hg19.genome
/usr/share/ugene/data/genome_lengths/mm10.genome
/usr/share/ugene/data/genome_lengths/mm8.genome
/usr/share/ugene/data/genome_lengths/mm9.genome
/usr/share/ugene/data/genome_lengths/test.genome
/usr/share/ugene/data/license
/usr/share/ugene/data/position_weight_matrix
/usr/share/ugene/data/position_weight_matrix/JASPAR
/usr/share/ugene/data/position_weight_matrix/JASPAR/all_jaspar.csv
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0265.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0266.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0267.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0268.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0269.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0270.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0271.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0272.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0273.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0274.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0275.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0276.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0277.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0278.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0279.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0280.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0281.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0282.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0283.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0284.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0285.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0286.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0287.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0288.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0289.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0290.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0291.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0292.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0293.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0294.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0295.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0296.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0297.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0298.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0299.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0300.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0301.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0302.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0303.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0304.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0305.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0306.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0307.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0308.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0309.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0310.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0311.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0312.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0313.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0314.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0315.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0316.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0317.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0318.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0319.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0320.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0321.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0322.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0323.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0324.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0325.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0326.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0327.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0328.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0329.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0330.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0331.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0332.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0333.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0334.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0335.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0336.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0337.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0338.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0339.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0340.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0341.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0342.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0343.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0344.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0345.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0346.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0347.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0348.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0349.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0350.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0351.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0352.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0353.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0354.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0355.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0356.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0357.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0358.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0359.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0360.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0361.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0362.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0363.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0364.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0365.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0366.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0367.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0368.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0369.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0370.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0371.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0372.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0373.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0374.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0375.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0376.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0377.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0378.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0379.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0380.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0381.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0382.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0383.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0384.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0385.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0386.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0387.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0388.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0389.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0390.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0391.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0392.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0393.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0394.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0395.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0396.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0397.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0398.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0399.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0400.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0401.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0402.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0403.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0404.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0405.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0406.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0407.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0408.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0409.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0410.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0411.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0412.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0413.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0414.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0415.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0416.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0417.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0418.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0419.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0420.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0421.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0422.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0423.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0424.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0425.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0426.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0427.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0428.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0429.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0430.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0431.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0432.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0433.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0434.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0435.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0436.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0437.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0438.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0439.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0440.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/MA0441.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/fungi/matrix_list.txt
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0010.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0011.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0012.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0013.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0015.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0016.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0022.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0023.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0026.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA00445.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0049.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0085.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0086.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0094.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0126.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0165.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0166.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0167.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0168.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0169.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0170.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0171.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0172.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0173.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0174.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0175.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0176.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0177.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0178.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0179.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0180.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0181.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0182.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0183.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0184.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0185.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0186.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0187.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0188.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0189.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0190.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0191.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0192.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0193.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0194.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0195.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0196.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0197.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0198.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0199.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0200.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0201.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0202.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0203.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0204.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0205.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0206.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0207.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0208.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0209.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0210.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0211.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0212.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0213.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0214.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0215.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0216.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0217.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0218.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0219.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0220.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0221.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0222.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0223.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0224.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0225.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0226.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0227.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0228.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0229.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0230.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0231.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0232.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0233.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0234.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0235.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0236.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0237.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0238.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0239.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0240.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0241.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0242.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0243.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0244.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0245.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0246.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0247.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0248.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0249.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0250.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0251.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0252.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0253.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0254.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0255.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0256.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0257.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0443.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0444.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0446.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0447.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0448.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0449.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0450.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0451.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0452.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0453.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0454.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0455.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0456.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0457.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0458.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0459.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/MA0460.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/insects/matrix_list.txt
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes/MA0260.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes/MA0261.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes/MA0262.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes/MA0263.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes/MA0264.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/nematodes/matrix_list.txt
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0001.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0005.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0008.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0020.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0021.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0034.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0044.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0045.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0053.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0054.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0064.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0082.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0096.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0097.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0110.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0120.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0121.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0123.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0127.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0128.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/MA0129.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/plants/matrix_list.txt
/usr/share/ugene/data/position_weight_matrix/JASPAR/urochordates
/usr/share/ugene/data/position_weight_matrix/JASPAR/urochordates/MA0118.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/urochordates/matrix_list.txt
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0002.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0003.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0004.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0006.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0007.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0009.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0014.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0017.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0018.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0019.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0024.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0025.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0027.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0028.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0029.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0030.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0031.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0032.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0033.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0035.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0036.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0037.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0038.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0039.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0040.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0041.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0042.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0043.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0046.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0047.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0048.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0050.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0051.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0052.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0055.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0056.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0057.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0058.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0059.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0060.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0061.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0062.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0063.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0065.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0066.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0067.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0068.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0069.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0070.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0071.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0072.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0073.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0074.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0075.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0076.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0077.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0078.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0079.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0080.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0081.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0083.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0084.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0087.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0088.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0089.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0090.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0091.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0092.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0093.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0095.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0098.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0099.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0100.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0101.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0102.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0103.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0104.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0105.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0106.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0107.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0108.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0109.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0111.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0112.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0113.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0114.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0115.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0116.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0117.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0119.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0122.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0124.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0125.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0130.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0131.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0132.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0133.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0135.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0136.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0137.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0138.2.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0139.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0140.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0141.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0142.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0143.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0144.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0145.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0146.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0147.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0148.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0149.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0150.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0151.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0152.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0153.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0154.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0155.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0156.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0157.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0158.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0159.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0160.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0161.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0162.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0163.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0164.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0258.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0259.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/MA0442.1.pfm
/usr/share/ugene/data/position_weight_matrix/JASPAR/vertebrates/matrix_list.txt
/usr/share/ugene/data/position_weight_matrix/UniPROBE
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Alx3_3418.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Alx4_1744.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Arx_1738.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Bapx1_2343.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Barhl1_2590.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Barhl2_3868.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Barx1_2877.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Barx2_3447.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Bsx_3483.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cart1_0997.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cart1_1275.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cdx1_2245.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cdx2_4272.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cphx_3484.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Crx_3485.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cutl1_3494.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Cutl1_3494.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dbx1_3486.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dbx2_3487.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dlx1_1741.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dlx2_2273.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dlx3_1030.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dlx4_3488.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dlx5_3419.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dmbx1_2277.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dobox4_3956.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Dobox5_3493.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Duxl_1286.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Emx2_3420.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/En1_3123.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/En2_0952.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Esx1_3124.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Evx1_3952.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Evx2_2645.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Gbx1_2883.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Gbx2_3110.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Gsc_2327.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Gsh2_3990.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hdx_3845.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hlx1_2350.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hlxb9_3422.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hmbox1_2674.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hmx1_3423.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hmx2_3424.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hmx3_3490.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Homez_1063.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa10_2318.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa11_2218.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa13_3126.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa1_3425.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa2_3079.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa3_2783.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa4_3426.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa5_3415.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa6_1040.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa7_2668.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa7_3750.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxa9_2622.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb13_3479.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb3_1720.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb4_2627.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb5_3122.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb6_3428.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb7_3953.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb8_3780.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxb9_3413.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc10_2779.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc11_3718.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc12_3480.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc13_3127.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc4_3491.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc5_2630.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc6_3954.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc8_3429.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxc9_2367.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd10_2368.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd11_3873.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd12_3481.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd13_2356.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd1_3448.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd3_1742.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Hoxd8_2644.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Ipf1_3815.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Irx2_0900.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Irx3_0920.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Irx3_2226.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Irx4_2242.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Irx5_2385.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Irx6_2623.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Isl2_3430.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Isx_3445.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lbx2_3869.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx1_2240.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx2_0953.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx3_3431.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx4_1719.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx5_2279.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx6_2272.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx6_3432.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx8_2247.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lhx9_3492.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lmx1a_2238.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Lmx1b_3433.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Meis1_2335.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Meox1_2310.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Mrg1_2246.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Mrg2_2302.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Msx1_3031.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Msx2_3449.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Msx3_3206.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx1-1_3856.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx1-2_3214.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx2-2_2823.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx2-3_3435.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx2-4_3074.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx2-5_3436.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx2-6_3437.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx2-9_3082.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx3-1_2923.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx6-1_2825.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx6-1_2825.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Nkx6-3_3446.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Obox1_3970.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Obox2_3438.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Obox3_3439.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Obox5_2284.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Obox5_3963.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Obox6_3440.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Og2x_3719.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Otp_3496.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Otx1_2325.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Otx2_3441.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pax4_3989.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pax6_3838.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pax7_3783.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pbx1_3203.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Phox2a_3947.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Phox2b_3948.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pitx1_2312.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pitx2_2274.3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pitx3_3497.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pknox1_2364.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pknox2_3077.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou1f1_3818.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou2f1_3081.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou2f2_3748.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou2f3_3986.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou3f1_3819.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou3f2_2824.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou3f3_3235.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou3f4_3773.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou4f3_2791.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou6f1_1731.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Pou6f1_3733.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Prop1_3949.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Prrx1_3442.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Prrx2_3072.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Rax_3443.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Rhox11_1765.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Rhox11_2205.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Rhox6_4251.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Shox2_2641.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Six1_0935.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Six2_2307.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Six3_1732.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Six4_2860.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Six6_2267.4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Six6_2267.5.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Tcf1_2666.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Tcf2_0913.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Tgif1_2342.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Tgif2_3451.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Titf1_1722.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Tlx2_3498.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Uncx4.1_2281.2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Vax1_3499.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Vax2_3500.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/Cell08/Vsx1_1728.1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Aft1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Aro80.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Asg1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Bas1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Cbf1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Cep3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Cha4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Cup9.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ecm22.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Fhl1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Fkh1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Fkh2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gal4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gat1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gat3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gat4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gcn4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gln3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gsm1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Gzf3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Hal9.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Leu3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Lys14.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Matalpha2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Mbp1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Mcm1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Met32.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Mga1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Mig1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Mig2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Mig3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ndt80.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Nhp6a.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Nhp6b.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Nrg1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Oaf1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Pbf1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Pbf2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Pdr1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Phd1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Pho2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Pho4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Put3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rap1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rdr1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rds1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rds2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rgt1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rph1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rpn4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rsc3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rsc30.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Rtg3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Sfl1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Sfp1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Sip4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Skn7.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Smp1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Spt15.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Srd1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Stb3.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Stp2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Stp4.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Sum1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Sut2.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Tbf1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Tbs1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Tea1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Tec1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Tye7.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ume6.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Usv1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Xbp1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yap1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yap6.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ybr239c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ydr520c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yer130c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ygr067c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ykl222c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yll054c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yml081w.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ynr063w.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yox1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ypr013c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ypr015c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Ypr196w.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yrm1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/GR09/Yrr1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/NBT06
/usr/share/ugene/data/position_weight_matrix/UniPROBE/NBT06/Cbf1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/NBT06/Ceh-22.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/NBT06/Oct-1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/NBT06/Rap1.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/NBT06/Zif268.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/PNAS08
/usr/share/ugene/data/position_weight_matrix/UniPROBE/PNAS08/Cgd2_3490.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/PNAS08/PF14_0633.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/PNAS08/PFF0200c.pwm
/usr/share/ugene/data/position_weight_matrix/UniPROBE/all_uniprobe.csv
/usr/share/ugene/data/primer3
/usr/share/ugene/data/primer3/drosophila.w.transposons.txt
/usr/share/ugene/data/primer3/humrep_and_simple.txt
/usr/share/ugene/data/primer3/rodent_ref.txt
/usr/share/ugene/data/primer3/rodrep_and_simple.txt
/usr/share/ugene/data/query_samples
/usr/share/ugene/data/query_samples/RepeatsWithORF.uql
/usr/share/ugene/data/query_samples/SimpleGene.uql
/usr/share/ugene/data/samples
/usr/share/ugene/data/samples/ABIF
/usr/share/ugene/data/samples/ABIF/A01.abi
/usr/share/ugene/data/samples/ACE
/usr/share/ugene/data/samples/ACE/BL060C3.ace
/usr/share/ugene/data/samples/ACE/K26.ace
/usr/share/ugene/data/samples/APR
/usr/share/ugene/data/samples/APR/DNA.apr
/usr/share/ugene/data/samples/APR/gyrA.apr
/usr/share/ugene/data/samples/Assembly
/usr/share/ugene/data/samples/Assembly/chrM.fa
/usr/share/ugene/data/samples/Assembly/chrM.sam
/usr/share/ugene/data/samples/Assembly/chrM.sorted.bam
/usr/share/ugene/data/samples/CLUSTALW
/usr/share/ugene/data/samples/CLUSTALW/COI.aln
/usr/share/ugene/data/samples/CLUSTALW/HIV-1.aln
/usr/share/ugene/data/samples/CLUSTALW/ty3.aln.gz
/usr/share/ugene/data/samples/EMBL
/usr/share/ugene/data/samples/EMBL/AF177870.emb
/usr/share/ugene/data/samples/EMBL/AL000263.emb
/usr/share/ugene/data/samples/FASTA
/usr/share/ugene/data/samples/FASTA/human_T1.fa
/usr/share/ugene/data/samples/FASTQ
/usr/share/ugene/data/samples/FASTQ/eas.fastq
/usr/share/ugene/data/samples/GFF
/usr/share/ugene/data/samples/GFF/5prime_utr_intron_A20.gff
/usr/share/ugene/data/samples/GFF/5prime_utr_intron_A21.gff
/usr/share/ugene/data/samples/Genbank
/usr/share/ugene/data/samples/Genbank/CVU55762.gb
/usr/share/ugene/data/samples/Genbank/NC_014267.1.gb
/usr/share/ugene/data/samples/Genbank/PBR322.gb
/usr/share/ugene/data/samples/Genbank/murine.gb
/usr/share/ugene/data/samples/Genbank/sars.gb
/usr/share/ugene/data/samples/HMM
/usr/share/ugene/data/samples/HMM/aligment15900.hmm
/usr/share/ugene/data/samples/MMDB
/usr/share/ugene/data/samples/MMDB/1CRN.prt
/usr/share/ugene/data/samples/MMDB/2JQS.prt
/usr/share/ugene/data/samples/MSF
/usr/share/ugene/data/samples/MSF/HMA.msf
/usr/share/ugene/data/samples/MSF/lipid8.msf
/usr/share/ugene/data/samples/MSF/pla2_20.msf
/usr/share/ugene/data/samples/Newick
/usr/share/ugene/data/samples/Newick/COI.nwk
/usr/share/ugene/data/samples/PDB
/usr/share/ugene/data/samples/PDB/1CF7.PDB
/usr/share/ugene/data/samples/PDB/1CRN.PDB
/usr/share/ugene/data/samples/PDB/3INS.PDB
/usr/share/ugene/data/samples/Raw
/usr/share/ugene/data/samples/Raw/raw.seq
/usr/share/ugene/data/samples/SCF
/usr/share/ugene/data/samples/SCF/90-JRI-07.scf
/usr/share/ugene/data/samples/Stockholm
/usr/share/ugene/data/samples/Stockholm/CBS.sto
/usr/share/ugene/data/samples/Stockholm/UPSK.sto
/usr/share/ugene/data/samples/Swiss-Prot
/usr/share/ugene/data/samples/Swiss-Prot/D0VTW9.txt
/usr/share/ugene/data/samples/Swiss-Prot/P01375.txt
/usr/share/ugene/data/samples/Swiss-Prot/P16152.txt
/usr/share/ugene/data/sitecon_models
/usr/share/ugene/data/sitecon_models/eukaryotic
/usr/share/ugene/data/sitecon_models/eukaryotic/CEBP_a.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/CEBPall.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/CLOCK.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/CRE.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/E2F1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/E2F1DP1sel1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/EGR1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Eklf.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/GATA1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/GATA_ALL.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Gata2.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Gata3.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/HMG1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/HNF1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/HNF3_4.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/HNF4.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/MYOGsel3.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/MyoD.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/NF1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/NFATp.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/NFkB_all.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/NFkB_hetero.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/NFkB_homo.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Nf_e2.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Nrf2.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Oct1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Oct_all.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/PPRE.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/Pu1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/SRE_can.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/STAT.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/STAT1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/TTF1.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/USF.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/cMyc_can.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/er2.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/irf.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/isre.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/nfy.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/p53.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/setCREB.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/setCREBzag.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/srf_all.sitecon.gz
/usr/share/ugene/data/sitecon_models/eukaryotic/yy1.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic
/usr/share/ugene/data/sitecon_models/prokaryotic/AgaR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/AraC.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/ArcA.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/ArgR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/CpxR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/Crp.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/CysB.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/CytR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/DeoR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/DnaA.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/FUR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/FadR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/FlhDC.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/Fnr.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/Frur.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/GALR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/GALS.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/GLPR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/GNTR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/HNS.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/ICLR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/IHF.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/ISCR1.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/ISCR3.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/LEXA.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/Lrp.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MALT.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MARA.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MELR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MLC.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MODE.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MetJ.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/MetR1.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NAC.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NAGC_new2.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NANR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NARL2.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NARP.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NTRC.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/NarL.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/OmpR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/OxyR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/PHOB.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/PHOP.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/PurR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/ROB.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/RcsB_1core.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/RcsB_2core.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/Rob2.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/TORR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/TRPR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/TyrR.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/fis_new1.sitecon.gz
/usr/share/ugene/data/sitecon_models/prokaryotic/soxS.sitecon.gz
/usr/share/ugene/data/snp_scripts
/usr/share/ugene/data/snp_scripts/SNPChIPTools.py
/usr/share/ugene/data/snp_scripts/pdb_uniprot_chain_map.lst.2
/usr/share/ugene/data/snp_scripts/protstability1d.py
/usr/share/ugene/data/snp_scripts/protstability3d.py
/usr/share/ugene/data/snp_scripts/rsnp.py
/usr/share/ugene/data/snp_scripts/snp2pdbsite.py
/usr/share/ugene/data/snp_scripts/update_d_db.py
/usr/share/ugene/data/translations.txt
/usr/share/ugene/data/weight_matrix
/usr/share/ugene/data/weight_matrix/blosum100.txt
/usr/share/ugene/data/weight_matrix/blosum30.txt
/usr/share/ugene/data/weight_matrix/blosum35.txt
/usr/share/ugene/data/weight_matrix/blosum40.txt
/usr/share/ugene/data/weight_matrix/blosum45.txt
/usr/share/ugene/data/weight_matrix/blosum50.txt
/usr/share/ugene/data/weight_matrix/blosum55.txt
/usr/share/ugene/data/weight_matrix/blosum60.txt
/usr/share/ugene/data/weight_matrix/blosum62.txt
/usr/share/ugene/data/weight_matrix/blosum65.txt
/usr/share/ugene/data/weight_matrix/blosum70.txt
/usr/share/ugene/data/weight_matrix/blosum75.txt
/usr/share/ugene/data/weight_matrix/blosum80.txt
/usr/share/ugene/data/weight_matrix/blosum85.txt
/usr/share/ugene/data/weight_matrix/blosum90.txt
/usr/share/ugene/data/weight_matrix/blosumn.txt
/usr/share/ugene/data/weight_matrix/dayhoff.txt
/usr/share/ugene/data/weight_matrix/dna.txt
/usr/share/ugene/data/weight_matrix/gonnet.txt
/usr/share/ugene/data/weight_matrix/identity.txt
/usr/share/ugene/data/weight_matrix/match.txt
/usr/share/ugene/data/weight_matrix/md_10.txt
/usr/share/ugene/data/weight_matrix/md_20.txt
/usr/share/ugene/data/weight_matrix/md_40.txt
/usr/share/ugene/data/weight_matrix/nuc.4.4.txt
/usr/share/ugene/data/weight_matrix/pam10.txt
/usr/share/ugene/data/weight_matrix/pam100.txt
/usr/share/ugene/data/weight_matrix/pam110.txt
/usr/share/ugene/data/weight_matrix/pam120.cdi.txt
/usr/share/ugene/data/weight_matrix/pam120.txt
/usr/share/ugene/data/weight_matrix/pam130.txt
/usr/share/ugene/data/weight_matrix/pam140.txt
/usr/share/ugene/data/weight_matrix/pam150.txt
/usr/share/ugene/data/weight_matrix/pam160.cdi.txt
/usr/share/ugene/data/weight_matrix/pam160.txt
/usr/share/ugene/data/weight_matrix/pam170.txt
/usr/share/ugene/data/weight_matrix/pam180.txt
/usr/share/ugene/data/weight_matrix/pam190.txt
/usr/share/ugene/data/weight_matrix/pam20.txt
/usr/share/ugene/data/weight_matrix/pam200.cdi.txt
/usr/share/ugene/data/weight_matrix/pam200.txt
/usr/share/ugene/data/weight_matrix/pam210.txt
/usr/share/ugene/data/weight_matrix/pam220.txt
/usr/share/ugene/data/weight_matrix/pam230.txt
/usr/share/ugene/data/weight_matrix/pam240.txt
/usr/share/ugene/data/weight_matrix/pam250.cdi.txt
/usr/share/ugene/data/weight_matrix/pam250.txt
/usr/share/ugene/data/weight_matrix/pam260.txt
/usr/share/ugene/data/weight_matrix/pam270.txt
/usr/share/ugene/data/weight_matrix/pam280.txt
/usr/share/ugene/data/weight_matrix/pam290.txt
/usr/share/ugene/data/weight_matrix/pam30.txt
/usr/share/ugene/data/weight_matrix/pam300.txt
/usr/share/ugene/data/weight_matrix/pam310.txt
/usr/share/ugene/data/weight_matrix/pam320.txt
/usr/share/ugene/data/weight_matrix/pam330.txt
/usr/share/ugene/data/weight_matrix/pam340.txt
/usr/share/ugene/data/weight_matrix/pam350.txt
/usr/share/ugene/data/weight_matrix/pam360.txt
/usr/share/ugene/data/weight_matrix/pam370.txt
/usr/share/ugene/data/weight_matrix/pam380.txt
/usr/share/ugene/data/weight_matrix/pam390.txt
/usr/share/ugene/data/weight_matrix/pam40.cdi.txt
/usr/share/ugene/data/weight_matrix/pam40.txt
/usr/share/ugene/data/weight_matrix/pam400.txt
/usr/share/ugene/data/weight_matrix/pam410.txt
/usr/share/ugene/data/weight_matrix/pam420.txt
/usr/share/ugene/data/weight_matrix/pam430.txt
/usr/share/ugene/data/weight_matrix/pam440.txt
/usr/share/ugene/data/weight_matrix/pam450.txt
/usr/share/ugene/data/weight_matrix/pam460.txt
/usr/share/ugene/data/weight_matrix/pam470.txt
/usr/share/ugene/data/weight_matrix/pam480.txt
/usr/share/ugene/data/weight_matrix/pam490.txt
/usr/share/ugene/data/weight_matrix/pam50.txt
/usr/share/ugene/data/weight_matrix/pam500.txt
/usr/share/ugene/data/weight_matrix/pam60.txt
/usr/share/ugene/data/weight_matrix/pam70.txt
/usr/share/ugene/data/weight_matrix/pam80.cdi.txt
/usr/share/ugene/data/weight_matrix/pam80.txt
/usr/share/ugene/data/weight_matrix/pam90.txt
/usr/share/ugene/data/weight_matrix/rna.txt
/usr/share/ugene/data/weight_matrix/vtml160.txt
/usr/share/ugene/data/weight_matrix/vtml200.txt
/usr/share/ugene/data/workflow_samples
/usr/share/ugene/data/workflow_samples/Alignment
/usr/share/ugene/data/workflow_samples/Alignment/basic_align.uwl
/usr/share/ugene/data/workflow_samples/Alignment/extract_msa_consensus_as_seq.uwl
/usr/share/ugene/data/workflow_samples/Alignment/extract_msa_consensus_as_text.uwl
/usr/share/ugene/data/workflow_samples/Conversions
/usr/share/ugene/data/workflow_samples/Conversions/faqual2fastq.uwl
/usr/share/ugene/data/workflow_samples/Conversions/msa2clustal.uwl
/usr/share/ugene/data/workflow_samples/Conversions/query2alignment.uwl
/usr/share/ugene/data/workflow_samples/Conversions/seq2gen.uwl
/usr/share/ugene/data/workflow_samples/Custom elements
/usr/share/ugene/data/workflow_samples/Custom elements/casava-fastq-filter.uwl
/usr/share/ugene/data/workflow_samples/Custom elements/fastq-trimmer.uwl
/usr/share/ugene/data/workflow_samples/Custom elements/script-dump-sequence-info.uwl
/usr/share/ugene/data/workflow_samples/Custom elements/script-linkdata-fetch-seq.uwl
/usr/share/ugene/data/workflow_samples/Custom elements/script-quality-filter.uwl
/usr/share/ugene/data/workflow_samples/Data marking
/usr/share/ugene/data/workflow_samples/Data marking/annotation_marker.uwl
/usr/share/ugene/data/workflow_samples/Data marking/length_marker.uwl
/usr/share/ugene/data/workflow_samples/Data merging
/usr/share/ugene/data/workflow_samples/Data merging/find-substrings.uwl
/usr/share/ugene/data/workflow_samples/Data merging/merge-sequence.uwl
/usr/share/ugene/data/workflow_samples/Data merging/tfbs.uwl
/usr/share/ugene/data/workflow_samples/HMMER
/usr/share/ugene/data/workflow_samples/HMMER/build-test-HMM.uwl
/usr/share/ugene/data/workflow_samples/HMMER/searchHMM.uwl
/usr/share/ugene/data/workflow_samples/NGS
/usr/share/ugene/data/workflow_samples/NGS/chipseq_coverage.uwl
/usr/share/ugene/data/workflow_samples/NGS/cistrome
/usr/share/ugene/data/workflow_samples/NGS/cistrome.uwl
/usr/share/ugene/data/workflow_samples/NGS/cistrome/chip_seq.uwl
/usr/share/ugene/data/workflow_samples/NGS/cistrome/chip_seq_with_control.uwl
/usr/share/ugene/data/workflow_samples/NGS/consensus.uwl
/usr/share/ugene/data/workflow_samples/NGS/extract_coverage.uwl
/usr/share/ugene/data/workflow_samples/NGS/extract_transcript_seq.uwl
/usr/share/ugene/data/workflow_samples/NGS/fastqc.uwl
/usr/share/ugene/data/workflow_samples/NGS/from_tools_menu_only
/usr/share/ugene/data/workflow_samples/NGS/from_tools_menu_only/ngs_assembly.uwl
/usr/share/ugene/data/workflow_samples/NGS/from_tools_menu_only/ngs_classification.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_assembly_illumina_pe.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_assembly_illumina_pe_nanopore.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_assembly_illumina_se.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_de_novo
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_de_novo/ngs_classification_de_novo_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_de_novo/ngs_classification_de_novo_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_parallel
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_parallel/ngs_classification_parallel_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_parallel/ngs_classification_parallel_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_serial
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_serial/ngs_classification_serial_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification/ngs_classification_serial/ngs_classification_serial_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification_de_novo.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification_parallel.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_classification_serial.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_transcriptomics_tophat_stringtie.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_transcriptomics_tuxedo.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_variant_annotation.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_variant_calling.uwl
/usr/share/ugene/data/workflow_samples/NGS/ngs_variant_calling_full.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_chip.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_dna.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/chipseq
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/chipseq/chipseq_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/chipseq/chipseq_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/dnaseq
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/dnaseq/dna_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/dnaseq/dna_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/rnaseq
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/rnaseq/rnaseq_filtration_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/rnaseq/rnaseq_filtration_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/rnaseq/rnaseq_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_ngs/rnaseq/rnaseq_single.uwl
/usr/share/ugene/data/workflow_samples/NGS/raw_rna.uwl
/usr/share/ugene/data/workflow_samples/NGS/tuxedo
/usr/share/ugene/data/workflow_samples/NGS/tuxedo/tuxedo_main.uwl
/usr/share/ugene/data/workflow_samples/NGS/tuxedo/tuxedo_main_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/tuxedo/tuxedo_no_novel_transcr.uwl
/usr/share/ugene/data/workflow_samples/NGS/tuxedo/tuxedo_no_novel_transcr_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/tuxedo/tuxedo_single_dataset.uwl
/usr/share/ugene/data/workflow_samples/NGS/tuxedo/tuxedo_single_dataset_paired.uwl
/usr/share/ugene/data/workflow_samples/NGS/unmapped_reads.uwl
/usr/share/ugene/data/workflow_samples/Sanger sequencing
/usr/share/ugene/data/workflow_samples/Sanger sequencing/trim-and-align.uwl
/usr/share/ugene/data/workflow_samples/Scenarios
/usr/share/ugene/data/workflow_samples/Scenarios/filter_matched.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/find_inverted_repeats.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/find_sequences.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/gene_by_gene_report.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/group_primers_pairs.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/intersect_annotations.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/length_filter.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/merge_sequence_annotation.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/pcr.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/remote_blasting.uwl
/usr/share/ugene/data/workflow_samples/Scenarios/translate_seq_and_compl.uwl
/usr/share/ugene/data/workflow_samples/Transcriptomics
/usr/share/ugene/data/workflow_samples/Transcriptomics/SearchTFBS.uwl
/usr/share/ugene/data/workflow_samples/users
/usr/share/ugene/data/workflow_samples/users/CASAVA FASTQ filter.usa
/usr/share/ugene/data/workflow_samples/users/Dump sequence info.usa
/usr/share/ugene/data/workflow_samples/users/FASTQ Trimmer.usa
/usr/share/ugene/data/workflow_samples/users/Get the first half of sequence.usa
/usr/share/ugene/data/workflow_samples/users/Get the second half of sequence.usa
/usr/share/ugene/data/workflow_samples/users/LengthMarker.usa
/usr/share/ugene/data/workflow_samples/users/LinkData Fetch.usa
/usr/share/ugene/data/workflow_samples/users/QualityFilter.usa
/usr/share/ugene/data/workflow_samples/users/Read one sequence.usa
The spaces in files are asking for trouble, please consider replacing them with underscore in next release. Thank you.
Собираю ugene с такими параметрами
%qmake_qt5 -r
INSTALL_LIBDIR=%{_libdir}
UGENE_WITHOUT_NON_FREE=1
UGENE_EXCLUDE_LIST_ENABLED=1
%make release
Получаю ошибку линкера. zlib установлен.
../../_release/libsamtools.a(bam_import.o): In function ks_getuntil2': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:20: undefined reference to
gzread'
../../_release/libsamtools.a(bam_import.o): In function __bam_get_lines': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:79: undefined reference to
gzdopen'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:95: undefined reference to gzclose' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:79: undefined reference to
gzopen64'
../../_release/libsamtools.a(bam_import.o): In function sam_header_read2': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:129: undefined reference to
gzdopen'
../../_release/libsamtools.a(bam_import.o): In function ks_getc': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:20: undefined reference to
gzread'
../../_release/libsamtools.a(bam_import.o): In function sam_header_read2': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:150: undefined reference to
gzclose'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:129: undefined reference to gzopen64' ../../_release/libsamtools.a(bam_import.o): In function
sam_open':
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:487: undefined reference to gzdopen' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:487: undefined reference to
gzopen64'
../../_release/libsamtools.a(bam_import.o): In function sam_close': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bam_import.c:500: undefined reference to
gzclose'
../../_release/libsamtools.a(razf.o): In function _razf_write': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:197: undefined reference to
deflate'
../../release/libsamtools.a(razf.o): In function razf_open_w': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:170: undefined reference to
deflateInit2'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:186: undefined reference to deflateSetHeader' ../../_release/libsamtools.a(razf.o): In function
razf_open_r':
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:389: undefined reference to inflateInit2_' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:390: undefined reference to
inflateEnd'
../../_release/libsamtools.a(razf.o): In function _razf_read': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:602: undefined reference to
inflate'
../../_release/libsamtools.a(razf.o): In function razf_flush': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:230: undefined reference to
deflate'
../../_release/libsamtools.a(razf.o): In function _razf_reset_read': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:709: undefined reference to
inflateReset'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:709: undefined reference to inflateReset' ../../_release/libsamtools.a(razf.o): In function
razf_close':
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:826: undefined reference to inflateEnd' ../../_release/libsamtools.a(razf.o): In function
razf_end_flush':
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:254: undefined reference to deflate' ../../_release/libsamtools.a(razf.o): In function
razf_close':
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/razf.c:800: undefined reference to deflateEnd' ../../_release/libsamtools.a(bgzf.o): In function
deflate_block':
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:312: undefined reference to deflate' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:314: undefined reference to
deflateEnd'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:306: undefined reference to deflateInit2_' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:330: undefined reference to
deflateEnd'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:347: undefined reference to crc32' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:348: undefined reference to
crc32'
../../release/libsamtools.a(bgzf.o): In function inflate_block': /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:385: undefined reference to
inflateInit2'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:390: undefined reference to inflate' /home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:396: undefined reference to
inflateEnd'
/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/libs_3rdparty/samtools/src/samtools/bgzf.c:392: undefined reference to `inflateEnd'
collect2: error: ld returned 1 exit status
make[2]: *** [Makefile.Release:743: ../../_release/libU2Algorithm.so.1.0.0] Error 1
make[2]: Leaving directory '/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/corelibs/U2Algorithm'
make[1]: *** [Makefile:40: release] Error 2
make[1]: Leaving directory '/home/user/abf/rpmbuild/BUILD/ugene-33.0/src/corelibs/U2Algorithm'
make: *** [Makefile:3015: sub-src-corelibs-U2Algorithm-release_ordered] Error 2
Starting from version 1.28.1 I am not able to build ugene on Debian
I want to pass these vars:
QMAKE_CFLAGS_ISYSTEM= QMAKE_CXXFLAGS_ISYSTEM= UGENE_WITHOUT_NON_FREE=1 UGENE_LRELEASE=lrelease-qt5 UGENE_LUPDATE=lupdate-qt5
but it fails with the following message:
cd obj-x86_64-linux-gnu && cmake .. -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON QMAKE_CFLAGS_ISYSTEM= QMAKE_CXXFLAGS_ISYSTEM= UGENE_WITHOUT_NON_FREE=1 UGENE_LRELEASE=lrelease-qt5 UGENE_LUPDATE=lupdate-qt5
CMake Error: The source directory "/build/ugene-1.28.1+dfsg/obj-x86_64-linux-gnu/UGENE_LUPDATE=lupdate-qt5" does not exist.
Specify --help for usage, or press the help button on the CMake GUI.
dh_auto_configure: cd obj-x86_64-linux-gnu && cmake .. -DCMAKE_INSTALL_PREFIX=/usr -DCMAKE_VERBOSE_MAKEFILE=ON -DCMAKE_BUILD_TYPE=None -DCMAKE_INSTALL_SYSCONFDIR=/etc -DCMAKE_INSTALL_LOCALSTATEDIR=/var -DCMAKE_EXPORT_NO_PACKAGE_REGISTRY=ON -DCMAKE_FIND_PACKAGE_NO_PACKAGE_REGISTRY=ON QMAKE_CFLAGS_ISYSTEM= QMAKE_CXXFLAGS_ISYSTEM= UGENE_WITHOUT_NON_FREE=1 UGENE_LRELEASE=lrelease-qt5 UGENE_LUPDATE=lupdate-qt5 returned exit code 1
Any hint is greatly appreciated.
Using Tools > Sanger Data Analysis > Read quality control and alignement
, in the FASTQ Quality Trimmer
box if I set the quality greater than 0, all the sequences are discarded.
I think the FASTQ conversion get rid of the quality or set it to 0.
My input files are chromatograms (.abi
). One example file can be found there : https://drive.google.com/open?id=0Bwt2y0cMI-oyRm1fVHpOcFhMYlU
While installing and testing Unipro on MacOS I recognized that the Application has no code signature at all:
> codesign --display /path/to/Unipro\ UGENE.app
Unipro UGENE.app: code object is not signed at all
Code Signature is important for Users and administrators to assure the integrity of an Application.
Apple has documentation on how to apply this for any application: https://developer.apple.com/library/archive/documentation/Security/Conceptual/CodeSigningGuide/Procedures/Procedures.html
This would really be helpful to make Ugene more trustable and better useable inside the MacOS Framework.
Ugene doesn't display alignments to the reverse strand at all (no warnings, no options etc). At the example pictures below you can see that Ugene doesn't display or refer to region near 630000 that is mapped to the reverse strand (blue color at the IGB screenshot) . The same behaviour observed for Ugene 30xx (2020) and for the latest 45.1 version.
It would be good to have it fixed somehow. I attach the reduced bam file to check. Thanks in advance!
Qt version: 5.9
a type conversion bug between QLatin1String and QKeySequence
a recent change in Qt?
Error output:
In file included from src/bowtie2/Bowtie2SettingsWidget.h:25:0,
from src/ExternalToolSupportPlugin.cpp:79:
_tmp/ui/ui_Bowtie2Settings.h: In member function ‘void Ui_Bowtie2Settings::setupUi(QWidget*)’:
_tmp/ui/ui_Bowtie2Settings.h:189:52: error: no matching function for call to ‘QCheckBox::setShortcut(QLatin1String)’
gbarCheckBox->setShortcut(QLatin1String(""));
^
In file included from /usr/include/qt/QtWidgets/qpushbutton.h:44:0,
from /usr/include/qt/QtWidgets/QPushButton:1,
from _tmp/ui/ui_ETSSettingsWidget.h:20,
from src/ExternalToolSupportSettingsController.h:27,
from src/ExternalToolSupportPlugin.cpp:59:
/usr/include/qt/QtWidgets/qabstractbutton.h:87:10: note: candidate: void QAbstractButton::setShortcut(const QKeySequence&)
void setShortcut(const QKeySequence &key);
^~~~~~~~~~~
/usr/include/qt/QtWidgets/qabstractbutton.h:87:10: note: no known conversion for argument 1 from ‘QLatin1String’ to ‘const QKeySequence&’
make[2]: *** [Makefile.Release:15636: _tmp/obj/release/ExternalToolSupportPlugin.o] Error 1
make[2]: Leaving directory '/home/jens/.cache/aursync/ugene/src/ugene-1.28.0/src/plugins/external_tool_support'
make[1]: *** [Makefile:40: release] Error 2
make[1]: Leaving directory '/home/jens/.cache/aursync/ugene/src/ugene-1.28.0/src/plugins/exter
First of all, thank you for developing for such a scientific tool.
I am on Ubuntu 16.04 platform. I cloned the repository, and built it, and run it like
export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:. ; ./ugeneui
from ./ugene/src/_release
directory. It launches successfully, but it's missing all the plugins in >settings>plugins
though they exist in ./ugene/src/_release/plugins
I compiled and ran version 1.28-dev
last year successfully, it loads plugins without prpblem.
Regards.
Compilation fails on Archlinux using gcc 6.1.1:
g++ -c -pipe -O2 -march=x86-64 -mtune=generic -O2 -pipe -fstack-protector-strong -w -D_REENTRANT -fPIC -DU2_DISTRIBUTION_INFO=sources -DUGENE_VERSION=1.22.0 -DUGENE_VER_MAJOR=1 -DUGENE_VER_MINOR=22 -DUGENE_VER_PATCH=0 -DUGENE_X86_64 -DUGENE_DATA_DIR=\"/usr/share/ugene/data\" -DHI_EXCLUDED -DNDEBUG -DQT_NO_DEBUG -DQT_CORE_LIB -I. -isystem /usr/include/qt5 -isystem /usr/include -Isrc -isystem /usr/include/qt -isystem /usr/include/qt/QtCore -Irelease -I/usr/lib/qt/mkspecs/linux-g++ -o _tmp/obj/release/thread_info.o src/client/linux/dump_writer_common/thread_info.cc In file included from /usr/include/c++/6.1.1/bits/stl_algo.h:59:0, from /usr/include/c++/6.1.1/algorithm:62, from src/client/linux/crash_generation/crash_generation_client.cc:36: /usr/include/c++/6.1.1/cstdlib:75:25: fatal error: stdlib.h: No such file or directory #include_next <stdlib.h> ^ compilation terminated.
This seems to be related to this gcc bug that is triggered by using -isystem in combination with including stdlib:
https://gcc.gnu.org/bugzilla/show_bug.cgi?id=70129
The response to this bug report sounds like it won't be fixed upstream in gcc as they advise to "Just don't to it".
I have a sequence containing only one gene and not much extra bases on either side of the start/stop codons. When I'm trying to design primers that overhang on either side with more bases than the length of the original fragment, I get no PCR products. Adding some random bases fixes this problem.
Hi, I failed to build ugene 39.0 for ArchLinux. Here the step I use:
cd ugen-39.0
qmake
make
error ouputs:
I_tmp/moc/release -I_tmp/ui -I/usr/lib/qt/mkspecs/linux-g++ -o _tmp/obj/release/moc_BioStruct3DGLWidget.o _tmp/moc/release/moc_BioStruct3DGLWidget.cpp
src/gl2ps/gl2ps.cpp: In function ‘void gl2psBuildBspTree(GL2PSbsptree*, GL2PSlist*)’:
src/gl2ps/gl2ps.cpp:1502:18: error: ‘prim’ may be used uninitialized [-Werror=maybe-uninitialized]
1502 | gl2psGetPlane(prim, tree->plane);
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~
src/gl2ps/gl2ps.cpp:1494:21: note: ‘prim’ declared here
1494 | GL2PSprimitive *prim, *frontprim = NULL, *backprim = NULL;
| ^~~~
src/gl2ps/gl2ps.cpp:1502:18: error: ‘prim’ may be used uninitialized [-Werror=maybe-uninitialized]
1502 | gl2psGetPlane(prim, tree->plane);
| ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~
src/gl2ps/gl2ps.cpp:1494:21: note: ‘prim’ declared here
1494 | GL2PSprimitive *prim, *frontprim = NULL, *backprim = NULL;
| ^~~~
cc1plus: some warnings being treated as errors
check the complete build log here
If I delete these two lines:
Lines 73 to 79 in 940a65a
# These warnings must be errors:
QMAKE_CXXFLAGS += -Werror=parentheses
QMAKE_CXXFLAGS += -Werror=return-type
QMAKE_CXXFLAGS += -Werror=uninitialized
QMAKE_CXXFLAGS += -Werror=unused-parameter
QMAKE_CXXFLAGS += -Werror=unused-variable
then I could build ugene without errors.
Hi guys,
the Info.plist in the Mac releases still shows the version as 40.0. This interferes with automatic deployment systems like Munki, which use the version information in Info.plist to determine which package to deploy. Could you please correct the Info.plist in the Mac releases ?
Excerpt from the Info.plist:
`
CFBundleIdentifier
net.ugene.ugene
<key>CFBundleVersion</key>
<string>40.0</string>
<key>CFBundleShortVersionString</key>
<string>40.0</string>
<key>CFBundleDisplayName</key>
<string>Unipro UGENE</string>
<key>CFBundleName</key>
<string>Unipro UGENE</string>
`
From https://chromium.googlesource.com/breakpad/breakpad/+/605c51ed96ad44b34c457bbca320e74e194c317e
On glibc > 2.33,
SIGSTKSZ
might not be constant (in which case
it expands to a call tosysconf
which returns along int
); see
https://sourceware.org/pipermail/libc-alpha/2020-October/118513.htmlPass unsigned explicitly to std::max, to avoid relying on template
argument deduction. This works both with the old-style constant
SIGSTKSZ
and the new configurable one.
Please cherry-pick the commit above, or do a bulk update of breakpad (+lss).
Dear Ugene developers, I feel that Ugene is very mature and in some ways better than IGV for working with genomic data. Thanks for developing.
However one crucial feature is either missing, or hard to find, or not documented. It is showing multiple data tracks in parallel, e.g. a genome view and one or more RNAseq runs (bam files) together in one window, ideally vertically separated. So that one can browse the genome and then see the corresponding reads from different samples for the selected genomic region. Similar to how it is implemented in IGV with its different track options.
Best regards
Hi,
I used the samtools to generate the bam file and import to the Ugene, but at some locations along the chromosome, the consensus sequence in Ugene is different from thoses in samtools tview. I choose to use the samtools algorithm in the Ugene. Does anyone know why?
Hi there, I have a problem with v1.26.2. It segfaults on exit (GUI).
It was build with
qmake-qt5 -r PREFIX=/usr CONFIG+=x64 QMAKE_CFLAGS_ISYSTEM=
make
I tried it on two different machines, same behaviour. Are there any changes to the way I build it necessary? Am I missing something?
Terminal output
$ LANG=C ugene -ui
getrlimit(RLIMIT_NOFILE) failed
ATTENTION: default value of option force_s3tc_enable overridden by environment.
/usr/lib/ugene/ugene: line 69: 26303 Segmentation fault (core dumped) "$dirname/$appname" "${params[@]}"
Output from the crash report window
Exception with code C++ exception - Segmentation fault: address not mapped.
Stack dump: /tmp/ugene_crashes/7d827e57-819c-92c5-170a6063-6e336cef.dmp
Operation system: Linux
CPU Info:
Vendor :AuthenticAMD��
logical cpus: 4
cpu cores: 4
hyper-threads: false
Memory Info: 3388Mb
UGENE version: 1.26.2 x64
UUID: {c51e34ea-da38-4fc0-be7b-71716338be7a}
ActiveWindow: None
Log:
AppMemory: 3306Mb;
[16:41:02.553] [Tasks] Promoting task {'BlastN' external tool search task} to 'Finished'
[16:41:02.553] [Tasks] Promoting task {BlastN validate task} to 'Finished'
[16:41:02.553] [Tasks] Promoting task {BlastP validate task} to 'Prepared'
[16:41:02.553] [Tasks] Promoting task {'BlastP' external tool search task} to 'Prepared'
[16:41:02.553] [Tasks] Promoting task {BlastP validate task} to 'Running'
[16:41:02.553] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.553] [Tasks] Promoting task {'BlastP' external tool search task} to 'Running'
[16:41:02.556] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.556] [Tasks] Promoting task {'BlastP' external tool search task} to 'Finished'
[16:41:02.556] [Tasks] Promoting task {BlastP validate task} to 'Finished'
[16:41:02.556] [Tasks] Promoting task {BlastX validate task} to 'Prepared'
[16:41:02.556] [Tasks] Promoting task {'BlastX' external tool search task} to 'Prepared'
[16:41:02.556] [Tasks] Promoting task {BlastX validate task} to 'Running'
[16:41:02.556] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.556] [Tasks] Promoting task {'BlastX' external tool search task} to 'Running'
[16:41:02.559] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.559] [Tasks] Promoting task {'BlastX' external tool search task} to 'Finished'
[16:41:02.559] [Tasks] Promoting task {BlastX validate task} to 'Finished'
[16:41:02.559] [Tasks] Promoting task {TBlastN validate task} to 'Prepared'
[16:41:02.559] [Tasks] Promoting task {'TBlastN' external tool search task} to 'Prepared'
[16:41:02.559] [Tasks] Promoting task {TBlastN validate task} to 'Running'
[16:41:02.559] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.559] [Tasks] Promoting task {'TBlastN' external tool search task} to 'Running'
[16:41:02.562] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.562] [Tasks] Promoting task {'TBlastN' external tool search task} to 'Finished'
[16:41:02.562] [Tasks] Promoting task {TBlastN validate task} to 'Finished'
[16:41:02.562] [Tasks] Promoting task {TBlastX validate task} to 'Prepared'
[16:41:02.562] [Tasks] Promoting task {'TBlastX' external tool search task} to 'Prepared'
[16:41:02.562] [Tasks] Promoting task {TBlastX validate task} to 'Running'
[16:41:02.562] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.562] [Tasks] Promoting task {'TBlastX' external tool search task} to 'Running'
[16:41:02.565] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.565] [Tasks] Promoting task {'TBlastX' external tool search task} to 'Finished'
[16:41:02.565] [Tasks] Promoting task {TBlastX validate task} to 'Finished'
[16:41:02.565] [Tasks] Promoting task {RPSBlast validate task} to 'Prepared'
[16:41:02.565] [Tasks] Promoting task {'RPSBlast' external tool search task} to 'Prepared'
[16:41:02.565] [Tasks] Promoting task {RPSBlast validate task} to 'Running'
[16:41:02.565] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.565] [Tasks] Promoting task {'RPSBlast' external tool search task} to 'Running'
[16:41:02.568] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.568] [Tasks] Promoting task {'RPSBlast' external tool search task} to 'Finished'
[16:41:02.568] [Tasks] Promoting task {RPSBlast validate task} to 'Finished'
[16:41:02.568] [Tasks] Promoting task {BlastDBCmd validate task} to 'Prepared'
[16:41:02.568] [Tasks] Promoting task {'BlastDBCmd' external tool search task} to 'Prepared'
[16:41:02.568] [Tasks] Promoting task {BlastDBCmd validate task} to 'Running'
[16:41:02.568] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.568] [Tasks] Promoting task {'BlastDBCmd' external tool search task} to 'Running'
[16:41:02.570] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.571] [Tasks] Promoting task {'BlastDBCmd' external tool search task} to 'Finished'
[16:41:02.571] [Tasks] Promoting task {BlastDBCmd validate task} to 'Finished'
[16:41:02.571] [Tasks] Promoting task {CAP3 validate task} to 'Prepared'
[16:41:02.571] [Tasks] Promoting task {'CAP3' external tool search task} to 'Prepared'
[16:41:02.571] [Tasks] Promoting task {CAP3 validate task} to 'Running'
[16:41:02.571] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.571] [Tasks] Promoting task {'CAP3' external tool search task} to 'Running'
[16:41:02.573] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.573] [Tasks] Promoting task {'CAP3' external tool search task} to 'Finished'
[16:41:02.574] [Tasks] Promoting task {CAP3 validate task} to 'Finished'
[16:41:02.574] [Tasks] Promoting task {Bowtie aligner validate task} to 'Prepared'
[16:41:02.574] [Tasks] Promoting task {'Bowtie aligner' external tool search task} to 'Prepared'
[16:41:02.574] [Tasks] Promoting task {Bowtie aligner validate task} to 'Running'
[16:41:02.574] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.574] [Tasks] Promoting task {'Bowtie aligner' external tool search task} to 'Running'
[16:41:02.578] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.578] [Tasks] Promoting task {'Bowtie aligner' external tool search task} to 'Finished'
[16:41:02.580] [Tasks] Promoting task {Bowtie aligner validate task} to 'Finished'
[16:41:02.581] [Tasks] Promoting task {Bowtie build indexer validate task} to 'Prepared'
[16:41:02.581] [Tasks] Promoting task {'Bowtie build indexer' external tool search task} to 'Prepared'
[16:41:02.581] [Tasks] Promoting task {Bowtie build indexer validate task} to 'Running'
[16:41:02.581] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.581] [Tasks] Promoting task {'Bowtie build indexer' external tool search task} to 'Running'
[16:41:02.584] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.584] [Tasks] Promoting task {'Bowtie build indexer' external tool search task} to 'Finished'
[16:41:02.584] [Tasks] Promoting task {Bowtie build indexer validate task} to 'Finished'
[16:41:02.584] [Tasks] Promoting task {Bowtie 2 aligner validate task} to 'Prepared'
[16:41:02.584] [Tasks] Promoting task {'Bowtie 2 aligner' external tool search task} to 'Prepared'
[16:41:02.584] [Tasks] Promoting task {Bowtie 2 aligner validate task} to 'Running'
[16:41:02.584] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.584] [Tasks] Promoting task {'Bowtie 2 aligner' external tool search task} to 'Running'
[16:41:02.587] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.587] [Tasks] Promoting task {'Bowtie 2 aligner' external tool search task} to 'Finished'
[16:41:02.587] [Tasks] Promoting task {Bowtie 2 aligner validate task} to 'Finished'
[16:41:02.587] [Tasks] Promoting task {Bowtie 2 build indexer validate task} to 'Prepared'
[16:41:02.587] [Tasks] Promoting task {'Bowtie 2 build indexer' external tool search task} to 'Prepared'
[16:41:02.587] [Tasks] Promoting task {Bowtie 2 build indexer validate task} to 'Running'
[16:41:02.588] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.588] [Tasks] Promoting task {'Bowtie 2 build indexer' external tool search task} to 'Running'
[16:41:02.590] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.590] [Tasks] Promoting task {'Bowtie 2 build indexer' external tool search task} to 'Finished'
[16:41:02.591] [Tasks] Promoting task {Bowtie 2 build indexer validate task} to 'Finished'
[16:41:02.591] [Tasks] Promoting task {Bowtie 2 index inspector validate task} to 'Prepared'
[16:41:02.591] [Tasks] Promoting task {'Bowtie 2 index inspector' external tool search task} to 'Prepared'
[16:41:02.591] [Tasks] Promoting task {Bowtie 2 index inspector validate task} to 'Running'
[16:41:02.591] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.591] [Tasks] Promoting task {'Bowtie 2 index inspector' external tool search task} to 'Running'
[16:41:02.593] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.593] [Tasks] Promoting task {'Bowtie 2 index inspector' external tool search task} to 'Finished'
[16:41:02.593] [Tasks] Promoting task {Bowtie 2 index inspector validate task} to 'Finished'
[16:41:02.594] [Tasks] Promoting task {BWA validate task} to 'Prepared'
[16:41:02.594] [Tasks] Promoting task {'BWA' external tool search task} to 'Prepared'
[16:41:02.594] [Tasks] Promoting task {BWA validate task} to 'Running'
[16:41:02.594] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.594] [Tasks] Promoting task {'BWA' external tool search task} to 'Running'
[16:41:02.596] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.596] [Tasks] Promoting task {'BWA' external tool search task} to 'Finished'
[16:41:02.596] [Tasks] Promoting task {BWA validate task} to 'Finished'
[16:41:02.597] [Tasks] Promoting task {SPAdes validate task} to 'Prepared'
[16:41:02.597] [Tasks] Promoting task {'SPAdes' external tool search task} to 'Prepared'
[16:41:02.597] [Tasks] Promoting task {SPAdes validate task} to 'Running'
[16:41:02.597] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.597] [Tasks] Promoting task {'SPAdes' external tool search task} to 'Running'
[16:41:02.599] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.599] [Tasks] Promoting task {'SPAdes' external tool search task} to 'Finished'
[16:41:02.599] [Tasks] Promoting task {SPAdes validate task} to 'Finished'
[16:41:02.600] [Tasks] Promoting task {SAMtools validate task} to 'Prepared'
[16:41:02.600] [Tasks] Promoting task {'SAMtools' external tool search task} to 'Prepared'
[16:41:02.600] [Tasks] Promoting task {SAMtools validate task} to 'Running'
[16:41:02.600] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.600] [Tasks] Promoting task {'SAMtools' external tool search task} to 'Running'
[16:41:02.602] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.602] [Tasks] Promoting task {'SAMtools' external tool search task} to 'Finished'
[16:41:02.602] [Tasks] Promoting task {SAMtools validate task} to 'Finished'
[16:41:02.602] [Tasks] Promoting task {BCFtools validate task} to 'Prepared'
[16:41:02.603] [Tasks] Promoting task {'BCFtools' external tool search task} to 'Prepared'
[16:41:02.603] [Tasks] Promoting task {BCFtools validate task} to 'Running'
[16:41:02.603] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.603] [Tasks] Promoting task {'BCFtools' external tool search task} to 'Running'
[16:41:02.605] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.605] [Tasks] Promoting task {'BCFtools' external tool search task} to 'Finished'
[16:41:02.605] [Tasks] Promoting task {BCFtools validate task} to 'Finished'
[16:41:02.605] [Tasks] Promoting task {Tabix validate task} to 'Prepared'
[16:41:02.605] [Tasks] Promoting task {'Tabix' external tool search task} to 'Prepared'
[16:41:02.605] [Tasks] Promoting task {Tabix validate task} to 'Running'
[16:41:02.605] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.606] [Tasks] Promoting task {'Tabix' external tool search task} to 'Running'
[16:41:02.608] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.608] [Tasks] Promoting task {'Tabix' external tool search task} to 'Finished'
[16:41:02.608] [Tasks] Promoting task {Tabix validate task} to 'Finished'
[16:41:02.608] [Tasks] Promoting task {Spidey validate task} to 'Prepared'
[16:41:02.608] [Tasks] Promoting task {'Spidey' external tool search task} to 'Prepared'
[16:41:02.608] [Tasks] Promoting task {Spidey validate task} to 'Running'
[16:41:02.608] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.609] [Tasks] Promoting task {'Spidey' external tool search task} to 'Running'
[16:41:02.611] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.611] [Tasks] Promoting task {'Spidey' external tool search task} to 'Finished'
[16:41:02.611] [Tasks] Promoting task {Spidey validate task} to 'Finished'
[16:41:02.611] [Tasks] Promoting task {bedtools validate task} to 'Prepared'
[16:41:02.611] [Tasks] Promoting task {'bedtools' external tool search task} to 'Prepared'
[16:41:02.611] [Tasks] Promoting task {bedtools validate task} to 'Running'
[16:41:02.611] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.611] [Tasks] Promoting task {'bedtools' external tool search task} to 'Running'
[16:41:02.614] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.614] [Tasks] Promoting task {'bedtools' external tool search task} to 'Finished'
[16:41:02.614] [Tasks] Promoting task {bedtools validate task} to 'Finished'
[16:41:02.614] [Tasks] Promoting task {cutadapt validate task} to 'Prepared'
[16:41:02.614] [Tasks] Promoting task {'cutadapt' external tool search task} to 'Prepared'
[16:41:02.614] [Tasks] Promoting task {cutadapt validate task} to 'Running'
[16:41:02.614] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.614] [Tasks] Promoting task {'cutadapt' external tool search task} to 'Running'
[16:41:02.617] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.617] [Tasks] Promoting task {'cutadapt' external tool search task} to 'Finished'
[16:41:02.617] [Tasks] Promoting task {cutadapt validate task} to 'Finished'
[16:41:02.617] [Tasks] Promoting task {bigwig validate task} to 'Prepared'
[16:41:02.617] [Tasks] Promoting task {'bigwig' external tool search task} to 'Prepared'
[16:41:02.617] [Tasks] Promoting task {bigwig validate task} to 'Running'
[16:41:02.617] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.617] [Tasks] Promoting task {'bigwig' external tool search task} to 'Running'
[16:41:02.620] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.620] [Tasks] Promoting task {'bigwig' external tool search task} to 'Finished'
[16:41:02.620] [Tasks] Promoting task {bigwig validate task} to 'Finished'
[16:41:02.620] [Tasks] Promoting task {TopHat validate task} to 'Prepared'
[16:41:02.620] [Tasks] Promoting task {'TopHat' external tool search task} to 'Prepared'
[16:41:02.620] [Tasks] Promoting task {TopHat validate task} to 'Running'
[16:41:02.620] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.620] [Tasks] Promoting task {'TopHat' external tool search task} to 'Running'
[16:41:02.623] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.623] [Tasks] Promoting task {'TopHat' external tool search task} to 'Finished'
[16:41:02.623] [Tasks] Promoting task {TopHat validate task} to 'Finished'
[16:41:02.623] [Tasks] Promoting task {Cuffcompare validate task} to 'Prepared'
[16:41:02.623] [Tasks] Promoting task {'Cuffcompare' external tool search task} to 'Prepared'
[16:41:02.623] [Tasks] Promoting task {Cuffcompare validate task} to 'Running'
[16:41:02.623] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.623] [Tasks] Promoting task {'Cuffcompare' external tool search task} to 'Running'
[16:41:02.627] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.627] [Tasks] Promoting task {'Cuffcompare' external tool search task} to 'Finished'
[16:41:02.628] [Tasks] Promoting task {Cuffcompare validate task} to 'Finished'
[16:41:02.628] [Tasks] Promoting task {Cuffdiff validate task} to 'Prepared'
[16:41:02.628] [Tasks] Promoting task {'Cuffdiff' external tool search task} to 'Prepared'
[16:41:02.628] [Tasks] Promoting task {Cuffdiff validate task} to 'Running'
[16:41:02.628] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.628] [Tasks] Promoting task {'Cuffdiff' external tool search task} to 'Running'
[16:41:02.631] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.631] [Tasks] Promoting task {'Cuffdiff' external tool search task} to 'Finished'
[16:41:02.631] [Tasks] Promoting task {Cuffdiff validate task} to 'Finished'
[16:41:02.632] [Tasks] Promoting task {Cufflinks validate task} to 'Prepared'
[16:41:02.632] [Tasks] Promoting task {'Cufflinks' external tool search task} to 'Prepared'
[16:41:02.632] [Tasks] Promoting task {Cufflinks validate task} to 'Running'
[16:41:02.632] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.632] [Tasks] Promoting task {'Cufflinks' external tool search task} to 'Running'
[16:41:02.634] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.634] [Tasks] Promoting task {'Cufflinks' external tool search task} to 'Finished'
[16:41:02.634] [Tasks] Promoting task {Cufflinks validate task} to 'Finished'
[16:41:02.635] [Tasks] Promoting task {Cuffmerge validate task} to 'Prepared'
[16:41:02.635] [Tasks] Promoting task {'Cuffmerge' external tool search task} to 'Prepared'
[16:41:02.635] [Tasks] Promoting task {Cuffmerge validate task} to 'Running'
[16:41:02.635] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.635] [Tasks] Promoting task {'Cuffmerge' external tool search task} to 'Running'
[16:41:02.637] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.637] [Tasks] Promoting task {'Cuffmerge' external tool search task} to 'Finished'
[16:41:02.638] [Tasks] Promoting task {Cuffmerge validate task} to 'Finished'
[16:41:02.638] [Tasks] Promoting task {Gffread validate task} to 'Prepared'
[16:41:02.638] [Tasks] Promoting task {'Gffread' external tool search task} to 'Prepared'
[16:41:02.638] [Tasks] Promoting task {Gffread validate task} to 'Running'
[16:41:02.638] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.638] [Tasks] Promoting task {'Gffread' external tool search task} to 'Running'
[16:41:02.640] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.640] [Tasks] Promoting task {'Gffread' external tool search task} to 'Finished'
[16:41:02.641] [Tasks] Promoting task {Gffread validate task} to 'Finished'
[16:41:02.641] [Tasks] Promoting task {MACS validate task} to 'Prepared'
[16:41:02.641] [Tasks] Promoting task {'MACS' external tool search task} to 'Prepared'
[16:41:02.641] [Tasks] Promoting task {MACS validate task} to 'Running'
[16:41:02.641] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.641] [Tasks] Promoting task {'MACS' external tool search task} to 'Running'
[16:41:02.643] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.643] [Tasks] Promoting task {'MACS' external tool search task} to 'Finished'
[16:41:02.644] [Tasks] Promoting task {MACS validate task} to 'Finished'
[16:41:02.644] [Tasks] Promoting task {peak2gene validate task} to 'Prepared'
[16:41:02.644] [Tasks] Promoting task {'peak2gene' external tool search task} to 'Prepared'
[16:41:02.644] [Tasks] Promoting task {peak2gene validate task} to 'Running'
[16:41:02.644] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.644] [Tasks] Promoting task {'peak2gene' external tool search task} to 'Running'
[16:41:02.646] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.646] [Tasks] Promoting task {'peak2gene' external tool search task} to 'Finished'
[16:41:02.647] [Tasks] Promoting task {peak2gene validate task} to 'Finished'
[16:41:02.647] [Tasks] Promoting task {vcfutils validate task} to 'Prepared'
[16:41:02.647] [Tasks] Promoting task {'vcfutils' external tool search task} to 'Prepared'
[16:41:02.647] [Tasks] Promoting task {vcfutils validate task} to 'Running'
[16:41:02.647] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.647] [Tasks] Promoting task {'vcfutils' external tool search task} to 'Running'
[16:41:02.649] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.649] [Tasks] Promoting task {'vcfutils' external tool search task} to 'Finished'
[16:41:02.650] [Tasks] Promoting task {vcfutils validate task} to 'Finished'
[16:41:02.650] [Tasks] Promoting task {SnpEff validate task} to 'Prepared'
[16:41:02.650] [Tasks] Promoting task {'SnpEff' external tool search task} to 'Prepared'
[16:41:02.650] [Tasks] Promoting task {SnpEff validate task} to 'Running'
[16:41:02.650] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.650] [Tasks] Promoting task {'SnpEff' external tool search task} to 'Running'
[16:41:02.652] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.652] [Tasks] Promoting task {'SnpEff' external tool search task} to 'Finished'
[16:41:02.653] [Tasks] Promoting task {SnpEff validate task} to 'Finished'
[16:41:02.653] [Tasks] Promoting task {FastQC validate task} to 'Prepared'
[16:41:02.653] [Tasks] Promoting task {'FastQC' external tool search task} to 'Prepared'
[16:41:02.653] [Tasks] Promoting task {FastQC validate task} to 'Running'
[16:41:02.653] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.653] [Tasks] Promoting task {'FastQC' external tool search task} to 'Running'
[16:41:02.655] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.655] [Tasks] Promoting task {'FastQC' external tool search task} to 'Finished'
[16:41:02.656] [Tasks] Promoting task {FastQC validate task} to 'Finished'
[16:41:02.656] [Tasks] Promoting task {HMMER build validate task} to 'Prepared'
[16:41:02.656] [Tasks] Promoting task {'HMMER build' external tool search task} to 'Prepared'
[16:41:02.656] [Tasks] Promoting task {HMMER build validate task} to 'Running'
[16:41:02.656] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.656] [Tasks] Promoting task {'HMMER build' external tool search task} to 'Running'
[16:41:02.658] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.658] [Tasks] Promoting task {'HMMER build' external tool search task} to 'Finished'
[16:41:02.658] [Tasks] Promoting task {HMMER build validate task} to 'Finished'
[16:41:02.659] [Tasks] Promoting task {HMMER search validate task} to 'Prepared'
[16:41:02.659] [Tasks] Promoting task {'HMMER search' external tool search task} to 'Prepared'
[16:41:02.659] [Tasks] Promoting task {HMMER search validate task} to 'Running'
[16:41:02.659] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.659] [Tasks] Promoting task {'HMMER search' external tool search task} to 'Running'
[16:41:02.661] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.661] [Tasks] Promoting task {'HMMER search' external tool search task} to 'Finished'
[16:41:02.661] [Tasks] Promoting task {HMMER search validate task} to 'Finished'
[16:41:02.661] [Tasks] Promoting task {PHMMER search validate task} to 'Prepared'
[16:41:02.661] [Tasks] Promoting task {'PHMMER search' external tool search task} to 'Prepared'
[16:41:02.662] [Tasks] Promoting task {PHMMER search validate task} to 'Running'
[16:41:02.662] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.662] [Tasks] Promoting task {'PHMMER search' external tool search task} to 'Running'
[16:41:02.664] [Core Services] AppResource Threads ::release 1, available 999
[16:41:02.664] [Tasks] Promoting task {'PHMMER search' external tool search task} to 'Finished'
[16:41:02.668] [Tasks] Promoting task {PHMMER search validate task} to 'Finished'
[16:41:02.704] [Tasks] Promoting task {Checking external tools} to 'Finished'
[16:41:02.705] [Tasks] Unregistering task: Checking external tools
[16:41:02.706] [Tasks] Deleting task: django validate task
[16:41:02.706] [Tasks] Deleting task: 'Rscript' external tool search task
[16:41:02.706] [Tasks] Deleting task: Rscript validate task
[16:41:02.706] [Tasks] Deleting task: 'ClustalW' external tool search task
[16:41:02.706] [Tasks] Deleting task: ClustalW validate task
[16:41:02.706] [Tasks] Deleting task: 'ClustalO' external tool search task
[16:41:02.706] [Tasks] Deleting task: ClustalO validate task
[16:41:02.706] [Tasks] Deleting task: 'MAFFT' external tool search task
[16:41:02.706] [Tasks] Deleting task: MAFFT validate task
[16:41:02.706] [Tasks] Deleting task: 'T-Coffee' external tool search task
[16:41:02.706] [Tasks] Deleting task: T-Coffee validate task
[16:41:02.706] [Tasks] Deleting task: 'MrBayes' external tool search task
[16:41:02.706] [Tasks] Deleting task: MrBayes validate task
[16:41:02.706] [Tasks] Deleting task: 'PhyML Maximum Likelihood' external tool search task
[16:41:02.706] [Tasks] Deleting task: PhyML Maximum Likelihood validate task
[16:41:02.706] [Tasks] Deleting task: 'FormatDB' external tool search task
[16:41:02.706] [Tasks] Deleting task: FormatDB validate task
[16:41:02.706] [Tasks] Deleting task: 'MakeBLASTDB' external tool search task
[16:41:02.706] [Tasks] Deleting task: MakeBLASTDB validate task
[16:41:02.706] [Tasks] Deleting task: 'BlastAll' external tool search task
[16:41:02.706] [Tasks] Deleting task: BlastAll validate task
[16:41:02.706] [Tasks] Deleting task: 'BlastN' external tool search task
[16:41:02.706] [Tasks] Deleting task: BlastN validate task
[16:41:02.706] [Tasks] Deleting task: 'BlastP' external tool search task
[16:41:02.706] [Tasks] Deleting task: BlastP validate task
[16:41:02.706] [Tasks] Deleting task: 'BlastX' external tool search task
[16:41:02.706] [Tasks] Deleting task: BlastX validate task
[16:41:02.707] [Tasks] Deleting task: 'TBlastN' external tool search task
[16:41:02.707] [Tasks] Deleting task: TBlastN validate task
[16:41:02.707] [Tasks] Deleting task: 'TBlastX' external tool search task
[16:41:02.707] [Tasks] Deleting task: TBlastX validate task
[16:41:02.707] [Tasks] Deleting task: 'RPSBlast' external tool search task
[16:41:02.707] [Tasks] Deleting task: RPSBlast validate task
[16:41:02.707] [Tasks] Deleting task: 'BlastDBCmd' external tool search task
[16:41:02.707] [Tasks] Deleting task: BlastDBCmd validate task
[16:41:02.707] [Tasks] Deleting task: 'CAP3' external tool search task
[16:41:02.707] [Tasks] Deleting task: CAP3 validate task
[16:41:02.707] [Tasks] Deleting task: 'Bowtie aligner' external tool search task
[16:41:02.707] [Tasks] Deleting task: Bowtie aligner validate task
[16:41:02.707] [Tasks] Deleting task: 'Bowtie build indexer' external tool search task
[16:41:02.707] [Tasks] Deleting task: Bowtie build indexer validate task
[16:41:02.707] [Tasks] Deleting task: 'Bowtie 2 aligner' external tool search task
[16:41:02.707] [Tasks] Deleting task: Bowtie 2 aligner validate task
[16:41:02.707] [Tasks] Deleting task: 'Bowtie 2 build indexer' external tool search task
[16:41:02.707] [Tasks] Deleting task: Bowtie 2 build indexer validate task
[16:41:02.707] [Tasks] Deleting task: 'Bowtie 2 index inspector' external tool search task
[16:41:02.707] [Tasks] Deleting task: Bowtie 2 index inspector validate task
[16:41:02.707] [Tasks] Deleting task: 'BWA' external tool search task
[16:41:02.707] [Tasks] Deleting task: BWA validate task
[16:41:02.707] [Tasks] Deleting task: 'SPAdes' external tool search task
[16:41:02.707] [Tasks] Deleting task: SPAdes validate task
[16:41:02.707] [Tasks] Deleting task: 'SAMtools' external tool search task
[16:41:02.707] [Tasks] Deleting task: SAMtools validate task
[16:41:02.707] [Tasks] Deleting task: 'BCFtools' external tool search task
[16:41:02.707] [Tasks] Deleting task: BCFtools validate task
[16:41:02.707] [Tasks] Deleting task: 'Tabix' external tool search task
[16:41:02.707] [Tasks] Deleting task: Tabix validate task
[16:41:02.707] [Tasks] Deleting task: 'Spidey' external tool search task
[16:41:02.707] [Tasks] Deleting task: Spidey validate task
[16:41:02.707] [Tasks] Deleting task: 'bedtools' external tool search task
[16:41:02.707] [Tasks] Deleting task: bedtools validate task
[16:41:02.707] [Tasks] Deleting task: 'cutadapt' external tool search task
[16:41:02.707] [Tasks] Deleting task: cutadapt validate task
[16:41:02.707] [Tasks] Deleting task: 'bigwig' external tool search task
[16:41:02.707] [Tasks] Deleting task: bigwig validate task
[16:41:02.707] [Tasks] Deleting task: 'TopHat' external tool search task
[16:41:02.707] [Tasks] Deleting task: TopHat validate task
[16:41:02.707] [Tasks] Deleting task: 'Cuffcompare' external tool search task
[16:41:02.707] [Tasks] Deleting task: Cuffcompare validate task
[16:41:02.707] [Tasks] Deleting task: 'Cuffdiff' external tool search task
[16:41:02.707] [Tasks] Deleting task: Cuffdiff validate task
[16:41:02.707] [Tasks] Deleting task: 'Cufflinks' external tool search task
[16:41:02.707] [Tasks] Deleting task: Cufflinks validate task
[16:41:02.707] [Tasks] Deleting task: 'Cuffmerge' external tool search task
[16:41:02.707] [Tasks] Deleting task: Cuffmerge validate task
[16:41:02.707] [Tasks] Deleting task: 'Gffread' external tool search task
[16:41:02.707] [Tasks] Deleting task: Gffread validate task
[16:41:02.707] [Tasks] Deleting task: 'MACS' external tool search task
[16:41:02.707] [Tasks] Deleting task: MACS validate task
[16:41:02.707] [Tasks] Deleting task: 'peak2gene' external tool search task
[16:41:02.708] [Tasks] Deleting task: peak2gene validate task
[16:41:02.708] [Tasks] Deleting task: 'vcfutils' external tool search task
[16:41:02.708] [Tasks] Deleting task: vcfutils validate task
[16:41:02.708] [Tasks] Deleting task: 'SnpEff' external tool search task
[16:41:02.708] [Tasks] Deleting task: SnpEff validate task
[16:41:02.708] [Tasks] Deleting task: 'FastQC' external tool search task
[16:41:02.708] [Tasks] Deleting task: FastQC validate task
[16:41:02.708] [Tasks] Deleting task: 'HMMER build' external tool search task
[16:41:02.708] [Tasks] Deleting task: HMMER build validate task
[16:41:02.708] [Tasks] Deleting task: 'HMMER search' external tool search task
[16:41:02.708] [Tasks] Deleting task: HMMER search validate task
[16:41:02.708] [Tasks] Deleting task: 'PHMMER search' external tool search task
[16:41:02.708] [Tasks] Deleting task: PHMMER search validate task
[16:41:02.708] [Tasks] Deleting task: Checking external tools
[16:41:02.760] [Tasks] Registering new task: Check for updates
[16:41:02.761] [Tasks] Registering new task: Checking access rights to the temporary folder
[16:41:02.762] [Tasks] Registering new task: Shtirlitz Startup Task
[16:41:02.973] [User Interface] Event Type: QEvent::Type(PolishRequest)
[16:41:02.973] [User Interface] Event Type: QEvent::Type(Polish)
[16:41:02.974] [User Interface] Event Type: QEvent::Type(ChildPolished)
[16:41:02.974] [User Interface] Event Type: QEvent::Type(LayoutRequest)
[16:41:02.976] [Tasks] Promoting task {Check for updates} to 'Prepared'
[16:41:02.976] [Tasks] Starting {Check for updates} task
[16:41:02.976] [Tasks] Promoting task {Checking access rights to the temporary folder} to 'Prepared'
[16:41:02.976] [Tasks] Promoting task {Shtirlitz Startup Task} to 'Prepared'
[16:41:02.976] [Core Services] AppResource Threads ::tryAcquire 1, available 1000
[16:41:02.976] [Tasks] Promoting task {Check for updates} to 'Running'
[16:41:02.976] [Core Services] AppResource Threads ::tryAcquire 1, available 999
[16:41:02.976] [Tasks] Promoting task {Checking access rights to the temporary folder} to 'Running'
[16:41:02.976] [Tasks] Promoting task {Shtirlitz Startup Task} to 'Running'
[16:41:03.021] [Tasks] Promoting task {Shtirlitz Startup Task} to 'Finished'
[16:41:03.028] [Core Services] AppResource Threads ::release 1, available 998
[16:41:03.028] [Tasks] Promoting task {Checking access rights to the temporary folder} to 'Finished'
[16:41:03.029] [Tasks] Unregistering task: Checking access rights to the temporary folder
[16:41:03.030] [Tasks] Deleting task: Checking access rights to the temporary folder
[16:41:03.030] [Tasks] Unregistering task: Shtirlitz Startup Task
[16:41:03.030] [Tasks] Deleting task: Shtirlitz Startup Task
[16:41:03.874] [User Interface] Event Type: QEvent::Type(DynamicPropertyChange)
[16:41:03.875] [User Interface] Event Type: QEvent::Type(StyleChange)
[16:41:03.875] [User Interface] Event Type: QEvent::Type(ParentChange)
[16:41:03.912] [User Interface] Event Type: QEvent::Type(StyleChange)
[16:41:03.912] [User Interface] Event Type: QEvent::Type(ParentChange)
[16:41:03.920] [User Interface] Event Type: QEvent::Type(WindowIconChange)
[16:41:03.920] [User Interface] Adding window: 'Start Page'
[16:41:03.921] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:03.921] [User Interface] Event Type: QEvent::Type(Move)
[16:41:03.921] [User Interface] Event Type: QEvent::Type(Resize)
[16:41:04.068] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.069] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.069] [User Interface] Event Type: QEvent::Type(Hide)
[16:41:04.070] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.070] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.070] [User Interface] Event Type: QEvent::Type(Move)
[16:41:04.070] [User Interface] Event Type: QEvent::Type(Resize)
[16:41:04.073] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.073] [User Interface] Event Type: QEvent::Type(Show)
[16:41:04.076] [User Interface] Event Type: QEvent::Type(Enter)
[16:41:04.077] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.077] [User Interface] Switching active MDI window from '<no window>' to 'Start Page'
[16:41:04.078] [User Interface] Event Type: QEvent::Type(Show)
[16:41:04.079] [User Interface] Event Type: QEvent::Type(ShowToParent)
[16:41:04.079] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.080] [User Interface] Event Type: QEvent::Type(Leave)
[16:41:04.080] [User Interface] Event Type: QEvent::Type(Hide)
[16:41:04.081] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.083] [User Interface] Event Type: QEvent::Type(Show)
[16:41:04.085] [User Interface] Event Type: QEvent::Type(Enter)
[16:41:04.085] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:04.123] [User Interface] Event Type: QEvent::Type(LayoutRequest)
[16:41:04.123] [User Interface] Event Type: QEvent::Type(UpdateLater)
[16:41:04.124] [User Interface] Event Type: QEvent::Type(UpdateLater)
[16:41:04.124] [User Interface] Event Type: QEvent::Type(UpdateLater)
[16:41:04.812] [User Interface] Event Type: QEvent::Type(ToolTip)
[16:41:13.484] [Core Services] AppResource Threads ::release 1, available 999
[16:41:13.484] [Tasks] Promoting task {Check for updates} to 'Finished'
[16:41:13.484] [Tasks] Task {Check for updates} finished
[16:41:13.493] [Tasks] Unregistering task: Check for updates
[16:41:13.493] [Tasks] Deleting task: Check for updates
[16:41:22.619] [User Interface] Event Type: QEvent::Type(ToolTip)
[16:41:31.074] [User Interface] Event Type: QEvent::Type(Leave)
[16:41:31.682] [User Actions] WINDOW SIZE: 1282x718
[16:41:31.684] [User Actions] mouse_press Left_button 26 23 CLASS_NAME: QMenuBar TEXT: &File
[16:41:31.820] [User Actions] mouse_release
[16:41:32.803] [User Actions] mouse_press Left_button 69 351 CLASS_NAME: QMenu TEXT: &Exit
[16:41:32.971] [User Actions] mouse_release
[16:41:32.972] [Tasks] Registering new task: Shutdown
[16:41:32.996] [User Interface] Event Type: QEvent::Type(Enter)
[16:41:33.012] [Core Services] Starting shutdown process...
[16:41:33.015] [Tasks] Promoting task {Shutdown} to 'Prepared'
[16:41:33.015] [Tasks] Promoting task {Close windows} to 'Prepared'
[16:41:33.015] [Tasks] Promoting task {Shutdown} to 'Running'
[16:41:33.015] [Tasks] Promoting task {Close windows} to 'Running'
[16:41:33.056] [Tasks] Promoting task {Close windows} to 'Finished'
[16:41:33.056] [Core Services] AppResource PluginViewer ::tryAcquire 1, available 1
[16:41:33.056] [Tasks] Promoting task {Disable 'PluginViewer' service} to 'Prepared'
[16:41:33.056] [Tasks] Promoting task {Disable PluginViewer} to 'Prepared'
[16:41:33.056] [Tasks] Promoting task {Disable 'PluginViewer' service} to 'Running'
[16:41:33.056] [Tasks] Promoting task {Disable PluginViewer} to 'Running'
[16:41:33.063] [Tasks] Promoting task {Disable PluginViewer} to 'Finished'
[16:41:33.102] [Tasks] Promoting task {Disable 'PluginViewer' service} to 'Finished'
[16:41:33.103] [Core Services] AppResource PluginViewer ::release 1, available 0
[16:41:33.103] [Core Services] AppResource Query Designer ::tryAcquire 1, available 1
[16:41:33.103] [Tasks] Promoting task {Disable 'Query Designer' service} to 'Prepared'
[16:41:33.103] [Tasks] Promoting task {Close Designer} to 'Prepared'
[16:41:33.103] [Tasks] Promoting task {Disable 'Query Designer' service} to 'Running'
[16:41:33.103] [Tasks] Promoting task {Close Designer} to 'Running'
[16:41:33.108] [Tasks] Promoting task {Close Designer} to 'Finished'
[16:41:33.109] [Tasks] Promoting task {Disable 'Query Designer' service} to 'Finished'
[16:41:33.109] [Core Services] AppResource Query Designer ::release 1, available 0
[16:41:33.110] [Core Services] AppResource Workflow Designer ::tryAcquire 1, available 1
[16:41:33.110] [Tasks] Promoting task {Disable 'Workflow Designer' service} to 'Prepared'
[16:41:33.110] [Tasks] Promoting task {Close Designer} to 'Prepared'
[16:41:33.110] [Tasks] Promoting task {Disable 'Workflow Designer' service} to 'Running'
[16:41:33.110] [Tasks] Promoting task {Close Designer} to 'Running'
[16:41:33.115] [Tasks] Promoting task {Close Designer} to 'Finished'
[16:41:33.118] [Tasks] Promoting task {Disable 'Workflow Designer' service} to 'Finished'
[16:41:33.123] [Core Services] AppResource Workflow Designer ::release 1, available 0
[16:41:33.124] [Core Services] AppResource Test runner ::tryAcquire 1, available 1
[16:41:33.124] [Tasks] Promoting task {Disable 'Test runner' service} to 'Prepared'
[16:41:33.124] [Tasks] Promoting task {Disable 'Test runner' service} to 'Running'
[16:41:33.136] [Tasks] Promoting task {Disable 'Test runner' service} to 'Finished'
[16:41:33.169] [Core Services] AppResource Test runner ::release 1, available 0
[16:41:33.174] [User Interface] Event Type: QEvent::Type(WindowDeactivate)
[16:41:33.175] [User Interface] Event Type: QEvent::Type(Hide)
[16:41:33.175] [User Interface] Event Type: QEvent::Type(WindowStateChange)
[16:41:33.175] [User Interface] Window deactivation, no MDI context switch, window: 'Start Page'
[16:41:33.176] [Tasks] Promoting task {Shutdown} to 'Finished'
[16:41:33.210] [Tasks] Unregistering task: Shutdown
[16:41:33.210] [Tasks] Deleting task: Close windows
[16:41:33.210] [Tasks] Deleting task: Disable PluginViewer
[16:41:33.210] [Tasks] Deleting task: Disable 'PluginViewer' service
[16:41:33.210] [Tasks] Deleting task: Close Designer
[16:41:33.210] [Tasks] Deleting task: Disable 'Query Designer' service
[16:41:33.210] [Tasks] Deleting task: Close Designer
[16:41:33.210] [Tasks] Deleting task: Disable 'Workflow Designer' service
[16:41:33.210] [Tasks] Deleting task: Disable 'Test runner' service
[16:41:33.210] [Tasks] Deleting task: Shutdown
Task tree:
None
Stack trace:
/usr/lib/ugene/libU2Private.so.1(_ZN2U229CrashHandlerPrivateUnixNotMac15storeStackTraceEv+0x1b5)[0x7f7fef4b9a55]
/usr/lib/ugene/libU2Private.so.1(_ZN2U212CrashHandler15handleExceptionERK7QStringS3_+0x45)[0x7f7fef4b79d5]
/usr/lib/ugene/libU2Private.so.1(_ZN2U229CrashHandlerPrivateUnixNotMac16breakpadCallbackERKN15google_breakpad18MinidumpDescriptorEPvb+0x93)[0x7f7fef4b9583]
/usr/lib/ugene/libbreakpad.so.1(_ZN15google_breakpad16ExceptionHandler12GenerateDumpEPNS0_12CrashContextE+0x428)[0x7f7fe5492cb8]
/usr/lib/ugene/libbreakpad.so.1(+0x9f05)[0x7f7fe5492f05]
/usr/lib/ugene/libbreakpad.so.1(_ZN15google_breakpad16ExceptionHandler13SignalHandlerEiP9siginfo_tPv+0xa8)[0x7f7fe5493068]
/usr/lib/libc.so.6(+0x33a90)[0x7f7fe70a9a90]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x1af)[0x7f7feeb5d47f]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD0Ev+0x9)[0x7f7feeb5d929]
/usr/lib/libQt5Core.so.5(_ZN14QObjectPrivate14deleteChildrenEv+0x71)[0x7f7fe7c6b411]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x36b)[0x7f7feeb5d63b]
/usr/lib/ugene/ugeneui[0x482631]
/usr/lib/libQt5Core.so.5(_ZN7QObject5eventEP6QEvent+0x120)[0x7f7fe7c6dbe0]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidget5eventEP6QEvent+0x54b)[0x7f7feeb61ecb]
/usr/lib/libQt5Widgets.so.5(_ZN11QMainWindow5eventEP6QEvent+0x16b)[0x7f7feec60d0b]
/usr/lib/libQt5Widgets.so.5(_ZN19QApplicationPrivate13notify_helperEP7QObjectP6QEvent+0x9c)[0x7f7feeb1a34c]
/usr/lib/libQt5Widgets.so.5(_ZN12QApplication6notifyEP7QObjectP6QEvent+0x261)[0x7f7feeb21b61]
/usr/lib/libQt5Core.so.5(_ZN16QCoreApplication15notifyInternal2EP7QObjectP6QEvent+0x110)[0x7f7fe7c41440]
/usr/lib/libQt5Core.so.5(_ZN23QCoreApplicationPrivate16sendPostedEventsEP7QObjectiP11QThreadData+0x2dd)[0x7f7fe7c43bcd]
/usr/lib/libQt5Quick.so.5(+0x278584)[0x7f7fe50c5584]
/usr/lib/libQt5Quick.so.5(_ZN19QQuickRenderControlD1Ev+0x40)[0x7f7fe50c5800]
/usr/lib/libQt5QuickWidgets.so.5(+0xd383)[0x7f7fe4c48383]
/usr/lib/libQt5QuickWidgets.so.5(+0xbfd3)[0x7f7fe4c46fd3]
/usr/lib/libQt5QuickWidgets.so.5(+0xc059)[0x7f7fe4c47059]
/usr/lib/libQt5Core.so.5(_ZN7QObjectD2Ev+0x677)[0x7f7fe7c74db7]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x3e3)[0x7f7feeb5d6b3]
/usr/lib/libQt5WebEngineWidgets.so.5(+0x30cba)[0x7f7fef251cba]
/usr/lib/libQt5WebEngineCore.so.5(+0x6a482b)[0x7f7fe965882b]
/usr/lib/libQt5WebEngineCore.so.5(+0x6a49b9)[0x7f7fe96589b9]
/usr/lib/libQt5WebEngineCore.so.5(+0xe8e57f)[0x7f7fe9e4257f]
/usr/lib/libQt5WebEngineCore.so.5(+0xe814a3)[0x7f7fe9e354a3]
/usr/lib/libQt5WebEngineCore.so.5(+0x102426e)[0x7f7fe9fd826e]
/usr/lib/libQt5WebEngineCore.so.5(+0xdfdaed)[0x7f7fe9db1aed]
/usr/lib/libQt5WebEngineCore.so.5(+0xdfdf89)[0x7f7fe9db1f89]
/usr/lib/libQt5WebEngineCore.so.5(+0xe0417d)[0x7f7fe9db817d]
/usr/lib/libQt5WebEngineCore.so.5(+0x102693b)[0x7f7fe9fda93b]
/usr/lib/libQt5WebEngineCore.so.5(+0x102216a)[0x7f7fe9fd616a]
/usr/lib/libQt5WebEngineCore.so.5(+0xf23104)[0x7f7fe9ed7104]
/usr/lib/libQt5WebEngineCore.so.5(+0xf23489)[0x7f7fe9ed7489]
/usr/lib/libQt5WebEngineCore.so.5(+0x6c141e)[0x7f7fe967541e]
/usr/lib/libQt5WebEngineCore.so.5(_ZN15QtWebEngineCore18WebContentsAdapterD1Ev+0x1a)[0x7f7fe967567a]
/usr/lib/libQt5WebEngineWidgets.so.5(+0x22cc6)[0x7f7fef243cc6]
/usr/lib/libQt5WebEngineWidgets.so.5(+0x22cd9)[0x7f7fef243cd9]
/usr/lib/libQt5WebEngineWidgets.so.5(_ZN14QWebEnginePageD1Ev+0x30)[0x7f7fef23e3f0]
/usr/lib/ugene/ugeneui[0x505457]
/usr/lib/libQt5Core.so.5(_ZN14QObjectPrivate14deleteChildrenEv+0x71)[0x7f7fe7c6b411]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x36b)[0x7f7feeb5d63b]
/usr/lib/ugene/ugeneui[0x5056f1]
/usr/lib/libQt5Core.so.5(_ZN14QObjectPrivate14deleteChildrenEv+0x71)[0x7f7fe7c6b411]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x36b)[0x7f7feeb5d63b]
/usr/lib/libQt5Widgets.so.5(_ZN13QMdiSubWindowD0Ev+0x9)[0x7f7feec81019]
/usr/lib/libQt5Core.so.5(_ZN14QObjectPrivate14deleteChildrenEv+0x71)[0x7f7fe7c6b411]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x36b)[0x7f7feeb5d63b]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD0Ev+0x9)[0x7f7feeb5d929]
/usr/lib/libQt5Core.so.5(_ZN14QObjectPrivate14deleteChildrenEv+0x71)[0x7f7fe7c6b411]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidgetD2Ev+0x36b)[0x7f7feeb5d63b]
/usr/lib/ugene/ugeneui[0x4f9141]
/usr/lib/libQt5Core.so.5(_ZN7QObject5eventEP6QEvent+0x120)[0x7f7fe7c6dbe0]
/usr/lib/libQt5Widgets.so.5(_ZN7QWidget5eventEP6QEvent+0x54b)[0x7f7feeb61ecb]
/usr/lib/libQt5Widgets.so.5(_ZN6QFrame5eventEP6QEvent+0x1e)[0x7f7feec49ece]
/usr/lib/libQt5Widgets.so.5(_ZN19QAbstractScrollArea5eventEP6QEvent+0x373)[0x7f7feecd37e3]
/usr/lib/libQt5Widgets.so.5(_ZN8QMdiArea5eventEP6QEvent+0x5b)[0x7f7feec7565b]
/usr/lib/libQt5Widgets.so.5(_ZN19QApplicationPrivate13notify_helperEP7QObjectP6QEvent+0x9c)[0x7f7feeb1a34c]
/usr/lib/libQt5Widgets.so.5(_ZN12QApplication6notifyEP7QObjectP6QEvent+0x261)[0x7f7feeb21b61]
/usr/lib/libQt5Core.so.5(_ZN16QCoreApplication15notifyInternal2EP7QObjectP6QEvent+0x110)[0x7f7fe7c41440]
/usr/lib/libQt5Core.so.5(_ZN23QCoreApplicationPrivate16sendPostedEventsEP7QObjectiP11QThreadData+0x2dd)[0x7f7fe7c43bcd]
/usr/lib/libQt5Core.so.5(_ZN16QCoreApplication4execEv+0xad)[0x7f7fe7c47dfd]
/usr/lib/ugene/ugeneui[0x4406e6]
/usr/lib/libc.so.6(__libc_start_main+0xf1)[0x7f7fe7096511]
/usr/lib/ugene/ugeneui[0x44ee0a]
The error messages I get are:
In file included from _tmp/moc/release/moc_CreateFragmentDialog.cpp:10:
_tmp/moc/release/../../../src/CreateFragmentDialog.h:48:41: error: implicit instantiation of undefined template
'QSet'
QSet enzymesSelection;
/Users/cm/Qt/Qt-5.14/5.14.0/clang_64/lib/QtCore.framework/Headers/qlist.h:72:29: note: template is declared here
template class QSet;
_tmp/moc/release/moc_CreateFragmentDialog.cpp:87:16: error: static_cast from 'U2::CreateFragmentDialog *' to
'Ui_CreateFragmentDialog ', which are not related by inheritance, is not allowed
return static_cast< Ui_CreateFragmentDialog>(this);
_tmp/moc/release/moc_CreateFragmentDialog.cpp:88:21: error: cannot initialize object parameter of type 'QDialog' with an
expression of type 'U2::CreateFragmentDialog'
return QDialog::qt_metacast(_clname);
_tmp/moc/release/moc_CreateFragmentDialog.cpp:93:20: error: cannot initialize object parameter of type 'QDialog' with an
expression of type 'U2::CreateFragmentDialog'
_id = QDialog::qt_metacall(_c, _id, _a);
Just curious if there are any plans to integrate some modern tools for RNAseq analysis, e.g. STAR
aligner, maybe together with StringTie
transctript assembler?
best,
Sven
Ubuntu 21.04 - Unable to install the dependencies listed in the README.
As described in the stack overflow, the following packages needed to be installed.
sudo apt-get install qtbase5-dev qtchooser qt5-qmake qtbase5-dev-tools
I also installed qtscript5-dev
and others as needed.
Just a report.
Thank you.
I noticed that http://beta.rest.ensembl.org
is not valid anymore, https://rest.ensembl.org
works for the time being.
For test case : https://rest.ensembl.org/sequence/id/ENSG00000205571?content-type=text/x-fasta
ugene/src/corelibs/U2Core/src/datatype/primers/PrimerStatistics.h
Lines 47 to 51 in 8065b4e
Primer search have an artificial limit in maximum and minimum size. While less common it can still be the case that you have primers that are smaller or larger than 15/50 bases. (Personally I got this issue when I had primers of 54 bases.)
I did a brief build of Ugene with the maximum increased to 200 (a common maximum primer size when ordering oligos) and this seems to work fine.
The SAM file was just 4.2 Gb. Hanged at 33% (before converting to Ugene database).
When I cleared cache by sysctl vm.drop_caches=1
, it went on at ~1%/sec and completed successfully.
vm memory consumption was 8.7Gb/15.4G
Hi,
when starting the cmdline utilities I get unclear error:
ugene local-blast+ --in=input.fa --dbpath=. --dbname=mydb --out=output.gb
Translation not found: transl_cs
I figured out there is just English and Russian localization but I guess many people will not realize. Make the tool revert to English by default, please.
LANG=en ugene --help=local-blast+
Hi I just saw a commit that said "Qt5.10 support" so I tried on Arch linux with Qt5.12 and this was the error message I got (compilation error in test_runner due to missing 'QtWebKit/QWebView'). A missing include in _tmp/ui/ui_Reporter.h?
make -f Makefile.Release make[2]: Entering directory '/home/jens/Devel/AUR/ugene-git/src/ugene/src/plugins/test_runner' make[2]: *** No rule to make target 'QtWebKit/QWebView', needed by '_tmp/ui/ui_Reporter.h'. Stop. make[2]: Leaving directory '/home/jens/Devel/AUR/ugene-git/src/ugene/src/plugins/test_runner' make[1]: *** [Makefile:40: release] Error 2 make[1]: Leaving directory '/home/jens/Devel/AUR/ugene-git/src/ugene/src/plugins/test_runner' make: *** [Makefile:2557: sub-src-plugins-test_runner-make_first-ordered] Error 2
Fedora 30, GCC 9.1.1, cmake 3.14.5, GNU Make 4.2.1, ninja 1.9.0.
[623/2312] Building CXX object src/corelibs/U2Formats/CMakeFiles/U2Formats.dir/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp.o
FAILED: src/corelibs/U2Formats/CMakeFiles/U2Formats.dir/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp.o
/usr/lib64/ccache/c++ -DBUILDING_U2FORMATS_DLL -DQT_CORE_LIB -DQT_FATAL_ASSERT -DQT_GUI_LIB -DQT_NETWORK_LIB -DQT_NO_DEBUG -DQT_SCRIPT_LIB -DQT_SQL_LIB -DQT_WIDGETS_LIB -DQT_XML_LIB -DU2Formats_EXPORTS -DUGENE_USE_BUNDLED_SQLITE -DUGENE_USE_BUNDLED_ZLIB -DUGENE_VERSION=33.0-dev -DUGENE_VER_MAJOR=33 -DUGENE_VER_MINOR=0 -DUGENE_WEB_KIT -Isrc/corelibs/U2Formats/U2Formats_autogen/include -I../src/corelibs/U2Formats/src -I../src/corelibs/U2Formats/../../include -I../src/corelibs/U2Formats/../../libs_3rdparty/samtools/src -I../src/corelibs/U2Formats/../../libs_3rdparty/samtools/src/samtools -isystem /usr/include/qt5 -isystem /usr/include/qt5/QtCore -isystem /usr/lib64/qt5/mkspecs/linux-g++ -isystem /usr/include/qt5/QtGui -isystem /usr/include/qt5/QtWidgets -isystem /usr/include/qt5/QtSql -isystem /usr/include/qt5/QtNetwork -isystem /usr/include/qt5/QtScript -isystem /usr/include/qt5/QtXml -fPIC -fPIC -std=gnu++11 -MD -MT src/corelibs/U2Formats/CMakeFiles/U2Formats.dir/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp.o -MF src/corelibs/U2Formats/CMakeFiles/U2Formats.dir/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp.o.d -o src/corelibs/U2Formats/CMakeFiles/U2Formats.dir/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp.o -c ../src/corelibs/U2Formats/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp
In file included from ../src/corelibs/U2Formats/../../include/U2Core/../../corelibs/U2Core/src/globals/U2SafePoints.h:34,
from ../src/corelibs/U2Formats/../../include/U2Core/U2SafePoints.h:1,
from ../src/corelibs/U2Formats/../../include/U2Core/../../corelibs/U2Core/src/dbi/U2AbstractDbi.h:39,
from ../src/corelibs/U2Formats/../../include/U2Core/U2AbstractDbi.h:1,
from ../src/corelibs/U2Formats/src/sqlite_dbi/assembly/../SQLiteDbi.h:27,
from ../src/corelibs/U2Formats/src/sqlite_dbi/assembly/../SQLiteAssemblyDbi.h:27,
from ../src/corelibs/U2Formats/src/sqlite_dbi/assembly/SingleTableAssemblyAdapter.h:25,
from ../src/corelibs/U2Formats/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.h:25,
from ../src/corelibs/U2Formats/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp:22:
../src/corelibs/U2Formats/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp: In member function „void U2::MultiTablePackAlgorithmAdapter::migrate(U2::MTASingleTableAdapter*, const QVector<U2::SQLiteReadTableMigrationData>&, qint64, qint64, U2::U2OpStatus&)”:
../src/corelibs/U2Formats/src/sqlite_dbi/assembly/MultiTableAssemblyAdapter.cpp:682:24: greška: „newProwRegion” was not declared in this scope
682 | assert(newProwRegion.contains(d.newProw));
| ^~~~~~~~~~~~~
[655/2312] Building CXX object src/corelibs/U2Lang/CMakeFiles/U2Lang.dir/src/support/serialize/HRSchemaSerializer.cpp.o
ninja: build stopped: subcommand failed.
Hi,
First of all, thank you all so much for your work on UGENE. I honestly can't imagine my life without this tool anymore. It generally does everything I want it to exactly the way I expect it to, and it's awesome. As a structural biologist without great bioinformatics skills, this is an awesome tool.
I have encountered an issue when trying to copy the amino acid translation of an annotation on the reverse strand. If I select the annotation with a single click, and select "Copy annotation amino acids", or press Ctrl+T (the shortcut key), instead of translating the reverse complement, it instead just translates from the 3'->5' direction. So for instance, the following gene (cmr5):
3'-TTAACCATATGGTAACGCCTCCAATACCTTTTTTATCTCATTTAAGTATGGAAGAATTAGCCTTTCTTCTTTAGACCCAACGCTAGAGGCTACGTCTAGTAATGAATAATATATATCCTTAGGGTCATCTCCTATCCTTATCCGTTTACCTATATTATTTAATACCAAGAGTATAATTGCTACGTAGCCAGCATAACCCGAACCTTCTCTTTTATCCAACTCCTTGCAAATTGAGGCAGGATTTCCTTTACCGCCTGATAGATAATTGTAAATGTCCTTAAAACGATTGTAATCCTCTATTTTTGAAATGTAGAATGTAAATGCAGGAGAAAACCCTATACCTAACATTAGTGATGGAAAATCTGCGGATCTCCTAAGCAATCCGGGTTTAGAAGGCCCGGATTGTATTTTACATTGGGCTGAAACTATTCTCTTACCTATCTCTGTAGCGAATTTAACGTATTCTGATTCCAA-5'
Translates as:
LTIW*RLQYLFYLI*VWKN*PFFFRPNARGYV***IIYILRVISYPYPFTYII*YQEYNCYVASITRTFSFIQLLAN*GRISFTA**IIVNVLKTIVILYF*NVECKCRRKPYT*H**WKICGSPKQSGFRRPGLYFTLG*NYSLTYLCSEFNVF*FQ
when it should translate as:
LESEYVKFATEIGKRIVSAQCKIQSGPSKPGLLRRSADFPSLMLGIGFSPAFTFYISKIEDYNRFKDIYNYLSGGKGNPASICKELDKREGSGYAGYVAIILLVLNNIGKRIRIGDDPKDIYYSLLDVASSVGSKEERLILPYLNEIKKVLEALPYG*
because the annotation is clearly on the reverse strand.
I don't know if this is a bug, or if it's intentional, but if it is intentional I'd recommend clarifying the language to be "Copy annotation direct strand amino acids", and add a keyboard shortcut for "Copy annotation amino acids" since most of the time, I suspect people will be interested in the translation of the gene of interest, not the out of frame translation of a reverse gene.
Again, thank you all for your work! I appreciate it so much!
Hello,
I am trying to build Ugene from source, because I want it to work with Cuda.
The error is as follows.
src/SWAlgorithmTask.cpp:23:26: fatal error: cuda_runtime.h: No such file or directory
#include<cuda_runtime.h>
compilation terminated.
src/sw_cuda_cpp.cpp:24:26: fatal error: cuda_runtime.h:
#include<cuda_runtime.h>
compilation terminated.
Makefile.Release:3468: recipe for target '_tmp/obj/release/SWAlgorithmTask.o' failed
make[2]: *** [_tmp/obj/release/SWAlgorithmTask.o] Error 1
Makefile.Release:4087: recipe for target '_tmp/obj/release/sw_cuda_cpp.o' failed
make[2]: *** waiting for job completed
make[2]: *** [_tmp/obj/release/sw_cuda_cpp.o] Error 1
make[2]: enterin directory '/home/.../ugene/src/plugins/smith_waterman'
Makefile:42: recipe for target 'release' failed
make[1]: *** [release] Error 2
make[1]: entering directory '/home/.../ugene/src/plugins/smith_waterman'
Makefile:3621: recipe for target 'sub-src-plugins-smith_waterman-release_ordered' failed
make: *** [sub-src-plugins-smith_waterman-release_ordered] Error 2
I did
I already checked this http://ugene.net/forum/YaBB.pl?num=1528031285/3, but I can't build Ugene. Why can't I build Ugene?
Environment:
Ubuntu 18.04
RTX 2080
NVIDIA Version 418.87.00
CUDA Version 10.1
Qt 5.13.1
using the latest source from github (1c3ad6f), I see the following error:
[ 50%] Building CXX object src/plugins/GUITestBase/CMakeFiles/GUITestBase.dir/src/GTDatabaseConfig.cpp.o
In file included from /home/sly/src/ugene/src/plugins/GUITestBase/../../include/U2Test/UGUITest.h:1,
from /home/sly/src/ugene/src/plugins/GUITestBase/src/GTDatabaseConfig.cpp:29:
/home/sly/src/ugene/src/plugins/GUITestBase/../../include/U2Test/../../corelibs/U2Test/src/gui_tests/UGUITest.h:27:10: fatal error: GTGlobals.h: No such file or directory
27 | #include <GTGlobals.h>
| ^~~~~~~~~~~~~
compilation terminated.
make[2]: *** [src/plugins/GUITestBase/CMakeFiles/GUITestBase.dir/build.make:69: src/plugins/GUITestBase/CMakeFiles/GUITestBase.dir/src/GTDatabaseConfig.cpp.o] Error 1
make[1]: *** [CMakeFiles/Makefile2:3031: src/plugins/GUITestBase/CMakeFiles/GUITestBase.dir/all] Error 2
make[1]: *** Waiting for unfinished jobs....
Oh, and for completeness, I'm trying to build like so:
mkdir build
cd build
cmake "-DCMAKE_INSTALL_PREFIX=/usr/local" ..
make -j14
For example, before UGENE_INSTALL_DIR
allowed caller to change data directory.
Now it just installs into $${PREFIX}/data which doesn't match where package data is expected to be installed.
The executable is now installed into ${PREFIX}/ugene
instead of ${PREFIX}/bin/ugane
.
Using qmake build on FreeBSD 13.1
when building ugene 42.0, I got this error:
g++ -c -pipe -Wall -march=x86-64 -mtune=generic -O2 -pipe -fno-plt -std=gnu++1y -w -D_REENTRANT -flto -fno-fat-lto-objects -fPIC -DUGENE_VERSION=42.0 -DQT_DISABLE_DEPRECATED_BEFORE=0x050700 -DNDEBUG -DQT_NO_DEBUG -DQT_CORE_LIB -I. -Isrc -I/usr/include/qt -I/usr/include/qt/QtCore -Irelease -I/usr/lib/qt/mkspecs/linux-g++ -o _tmp/obj/release/safe_readlink.o src/common/linux/safe_readlink.cc
src/client/linux/handler/exception_handler.cc: In function ‘void google_breakpad::{anonymous}::InstallAlternateStackLocked()’:
src/client/linux/handler/exception_handler.cc:144:49: error: no matching function for call to ‘max(int, long int)’
144 | static const unsigned kSigStackSize = std::max(16384, SIGSTKSZ);
| ~~~~~~~~^~~~~~~~~~~~~~~~~
In file included from /usr/include/c++/11.2.0/bits/char_traits.h:39,
from /usr/include/c++/11.2.0/string:40,
from src/client/linux/handler/exception_handler.h:38,
from src/client/linux/handler/exception_handler.cc:70:
this is caused by:
16384
is int
, but SIGSTKSZ
is long int
, change 16384
to 16384l
should fix it.
my step to build:
download the source tarball and extract and change dir to source dir, then
qmake CONFIG+=x64 \
UGENE_CUDA_DETECTED=0 \
UGENE_OPENCL_DETECTED=1 \
UGENE_USE_BUNDLED_ZLIB=0 \
UGENE_USE_BUNDLED_SQLITE=0
make
Новая версия ugene 36.0 не собирается с gcc5
g++: error: unrecognized command line option '-no-pie'
Hey!
I get a compilation error and cannot build the package in Arch.
This is the error I get:
"src/MuscleWorkPool.cpp: In constructor ‘U2::MuscleWorkPool::MuscleWorkPool(MuscleContext_, const U2::MuscleTaskSettings&, U2::TaskStateInfo&, int, const U2::MAlignment&, U2::MAlignment&, bool)’:
src/MuscleWorkPool.cpp:32:103: error: cannot convert ‘bool’ to ‘bool_’ in initialization
bReversed(false), bRight(false), History(NULL), bLockLeft(NULL), bLockRight(false), msaIn(NULL)
^
make[2]: *** [Makefile.Release:2607: _tmp/obj/release/MuscleWorkPool.o] Error 1"
Any ideas? Thanks!
The linux driver use functions provided by libX11:
When linking with "-Wl,--no-undefined", this causes built errors.
"-lX11"/"X11" should be added to the link libraries in both QSpec.pri and CMakeLists.txt.
Dear, lately there have been compilation issues with the AUR package of UGENE.
https://aur.archlinux.org/packages/ugene/
The compilation complains that isinf and isnan are not defined in hmmer3_funcs.cpp
math.h should be included in hmmer3_funcs.h, so I am not sure what is wrong.
I am guessing if it would be a glibc or gcc-bug, that a lot of packages would suffer from the same...
Are we missing a new Qt dependency?
Hi,
Is there an efficient way to export the consensus sequence when the data is fairly large? I try to export the chromosome 1 and the Ugene stopped working. I am wondering if there is linux command or other ways can handle this.
Thanks,
The Version numbering CFBundleShortVersionString
and CFBundleVersion
in the file Unipro UGENE.app/Contents/Info.plist
inside the DMG of the MacOS releases do not match up with the version numbers of the releases. They remained unchanged since version 40.0. Fixing that would make it easier to compare different versions.
I really appreciate this tool, flatpak packaging would ease the installation process and supply better support for Linux OSs.
After installing cuda and gcc-9, I am able to build with CUDA enabled but when I go to run the installed binary I get the following error:
sly@redbox:~/src/ugene$ ugene -ui
/usr/lib/ugene/ugeneui: symbol lookup error: /usr/lib/ugene/plugins/libsmith_waterman.so: undefined symbol: __cudaRegisterFatBinary
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.