Giter Club home page Giter Club logo

454-filter's Introduction

qfilt

This simple program is meant to filter sequencing data, optionally removing or splitting reads with poor quality scores and to optionally only retain fragments from reads that are tagged with a given 5' sequence.

BUILD & INSTALL

The build process requires CMake. To build, type:

cmake [-DINSTALL_PREFIX=/install/path (default=/usr/local)] .
make install

USAGE

qfilt [-h] [-o OUTPUT] [-q QSCORE] [-l LENGTH] [-m MODE] [-T PREFIX] [-t MISMATCH] (-F FASTQ | -Q FASTA QUAL)

To try it using the example data provided:

qfilt -Q data/test.fna data/test.qual -q 15 -l 30 -T ATATCGCGAGGA

OUTPUT:

stderr:

run settings:
    input fasta:         data/test.fna
    input qual:          data/test.qual
    min q-score:         15
    min fragment length: 30
    run mode:            0 (truncate/don't retain homopolymers/don't skip ambigs)
    5' tag:              ATATCGCGAGGA
    max tag mismatches:  0

run summary:
    original reads:      305
    contributing reads:  5
    retained fragments:  5

original read length distribution:
    mean:                96.9508
    median:              77
    variance             3743.03
    standard deviation:  61.1803
    min:                 49
    2.5%:                54
    97.5%:               332
    max:                 497

retained fragment length distribution:
    mean:                41
    median:              37
    variance             72.5
    standard deviation:  8.51469
    min:                 33
    2.5%:                33
    97.5%:               54
    max:                 54

stdout:

>GM98SRO01B77KU rank=0000671 x=796.0 y=1996.0 length=58
CCACGCGTATCGATGTCGACTTTTTTTTCTTTTCTTACATAGTAG
>GM98SRO01BA3RP rank=0000953 x=419.5 y=1603.5 length=87
CTGATGCTGCACCAACTGTACTCCCTCGCGATA
>GM98SRO01E1BKW rank=0001233 x=1948.0 y=846.0 length=66
TACAGTTGGTGCAGCATCAGAAAAGTACGACATCGATACGCGTGGTCCTCGCGA
>GM98SRO01DVVNY rank=0001304 x=1476.0 y=636.5 length=84
ACGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA
>GM98SRO01D6FIX rank=0001416 x=1596.0 y=1415.0 length=91
CGGCTGATGCTGCACCAACTGTACTCCCTCGCGATA

ARGUMENTS

-q QSCORE   : minimum per-base quality score below which a read will be split
              or truncated (default=20)

-l LENGTH   : minimum retained fragment LENGTH (default=50)

-m MODE     : MODE is a 3-bitmask (an integer in [0-7], default=0):
              if the lowest bit is set, a low q-score causes reads to be split,
              otherwise they are truncated;
              if the second bit is set, low q-score homopolymers are tolerated;
              and if the highest bit is set, low q-score 'N's are tolerated

-T PREFIX   : if supplied, only reads with this PREFIX are retained,
              and the PREFIX is stripped from each contributing read

-t MISMATCH : if PREFIX is supplied, prefix matching tolerates at most
              MISMATCH mismatches (default=0)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.