imgag / ngs-bits Goto Github PK

Hello,
when I run the current ORPHA-Import, I get several errors like this:

Warning: Skipping non-approved gene name 'GARS' for term 'ORPHA:99938'!

This example is a problem with old gene names. The current one (and one in the database) is GARS1.

In the ORPHA import, an additional call of genes2approved of the input would allow for the input of genes where the ORPHA-data does not contain the current gene-symbol.
If I read this correctly, this should be used in line 72 of the main.cpp.

Best,
Alex

git clone --recursive https://github.com/imgag/ngs-bits.git
cd ngs-bits/
make build_3rdparty
[ 99%] Building CXX object src/toolkit/CMakeFiles/bamtools_cmd.dir/bamtools_stats.cpp.o
[100%] Building CXX object src/toolkit/CMakeFiles/bamtools_cmd.dir/bamtools.cpp.o
Linking CXX executable ../../../bin/bamtools
make[3]: Leaving directory /save/ngs-bits/bamtools/build' [100%] Built target bamtools_cmd make[2]: Leaving directory /save/ngs-bits/bamtools/build'
make[1]: Leaving directory `/save/ngs-bits/bamtools/build'

make build_tools_release
rm -rf build-tools-Linux-Release;
mkdir -p build-tools-Linux-Release;
cd build-tools-Linux-Release;
qmake ../src/tools.pro "CONFIG-=debug" "CONFIG+=release" "DEFINES+=QT_NO_DEBUG_OUTPUT";
make;
qmake[1]: Entering directory /save/ngs-bits/build-tools-Linux-Release' qmake[1]: Nothing to be done for ../src/tools.pro'.
qmake[1]: Leaving directory /save/ngs-bits/build-tools-Linux-Release' make[1]: Entering directory /save/ngs-bits/build-tools-Linux-Release'
make[1]: *** No targets specified and no makefile found. Stop.
make[1]: Leaving directory `/save/ngs-bits/build-tools-Linux-Release'
make: *** [build_tools_release] Error 2

Use NCT classification

Two decision trees (from Sorin/Stephan):

• report variant yes/no
• relevance for therapy

Also allow overriding decision based on MTB decision.

Also use for somatic RNA report.

Haplotype based variant calling (e.g. Deletion and Missense variant in the same codon lead to wrong VEP preditctions), "complex INDELs"

Looks like there may be a numeric overflow issue in the counting for large samples:

From the SeqPurge output:

Reads (forward + reverse): -1672475124

Reads trimmed by insert match: 10318654
Reads trimmed by adapter match: 4348594
Reads trimmed by quality: 1169503679
Reads trimmed by N stretches: 933927
Trimmed reads: 14667248 of -1672475124 (-0.88%)
Removed reads: 2070757 of -1672475124 (-0.12%)
Removed bases: -3.36%

Data downloaded from here:
https://raw.githubusercontent.com/chapmanb/bcbio-nextgen/master/config/examples/cancer-giab-na12878-na24385-getdata.sh

The 24385-12878-30-200*.fastq.gz dataset has the issue.

• store the gene-disease-phenotype relation and source (HPO, OMIM, HGMD...) instead of the gene-phenotype relatipon in the NGSD
• also add stringency to each relation
• extend Phenotype filter in GSvar

../../src/cppNGS/VariantList.cpp:513:89: error: ‘class QList’ has no member named ‘join’

Separate functionality for GSvar and VCF files.

• VcfFile for VCF files
• VariantList for GSvar files

What happens now?

Hi,
I just recompiled the latest version of megSAP and GSvar (release 2019_08, as described in the docu for kompilation under Windows)
When I want to start GSVar, I get the following Error message:

It appears it can't get the correct path to the folder it resides in.

Best,
Alex

Hey,
when I followed the instructions for Windows to make GSvar portable, I got errors that specific libraries could not be found:

In the Documentation it says that you need the Qt5Charts.dll instead of the Qt5Chartsd.dll

The same is true for the following (from C:\Qt\Qt5.9.5\5.9.5\mingw53_32\bin\):
Qt5Charts.dll -> Qt5Chartsd.dll
Qt5Core.dll -> Qt5Cored.dll
Qt5Gui.dll -> Qt5Guid.dll
Qt5Network.dll -> Qt5Networkd.dll
Qt5PrintSupport.dll -> Qt5PrintSupportd.dll
Qt5Sql.dll -> Qt5Sqld.dll
Qt5Widgets.dll -> Qt5Widgetsd.dll
Qt5Xml.dll -> Qt5Xmld.dll
Qt5XmlPatterns.dll -> Qt5XmlPatternsd.dll

Additionally, would it be possible to order the libraries in the table alphabetically, this makes it a lot easier to extract them from the directories.

Thank you

Alex

Hi, I'm getting this when running make build_tools_release, in a GNU Guix build environment:

cd cppCORE/ && ( test -e Makefile || /gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/bin/qmake /tmp/guix-build-ngs-bits-0-1.c39f1807.drv-0/source/src/cppCORE/cppCORE.pro CONFIG-=debug CONFIG+=release DEFINES+=QT_NO_DEBUG_OUTPUT -o Makefile ) && make -f Makefile 
Cannot find file: /tmp/guix-build-ngs-bits-0-1.c39f1807.drv-0/source/src/cppCORE/cppCORE.pro.
make[1]: *** [Makefile:117: sub-cppCORE-make_first] Error 2
make[1]: Leaving directory '/tmp/guix-build-ngs-bits-0-1.c39f1807.drv-0/source/build-tools-Linux-Release'
make: *** [Makefile:46: build_tools_release] Error 2

I get this when running make build_3rdparty beforehand or not. Is this a file missing from the repo or something?
ta, ben

• store the source (HPO, OMIM, HGMD...) of each HPO term - gene relation in the NGSD
• add stringency to each relation
• extend Phenotype filter in GSvar

Installation is reasonably easy, we could link to https://git-lfs.github.com/ for installation guidance.
However the amount of storage offered by GitHub is not quite sufficient for our usage. I will try to contact JFrog about this matter.

Hi, Very nice set of tools. I installed with the condo pipeline and SampleAncestry seems to be missing.

Thanks

Getting following error:

ToolBase.o ../../src/cppCORE/ToolBase.cpp
../../src/cppCORE/ToolBase.cpp: In member function ‘void ToolBase::sortChangeLog()’:
../../src/cppCORE/ToolBase.cpp:566: error: expected primary-expression before ‘[’ token
../../src/cppCORE/ToolBase.cpp:566: error: expected primary-expression before ‘]’ token
../../src/cppCORE/ToolBase.cpp:566: error: expected primary-expression before ‘const’
../../src/cppCORE/ToolBase.cpp:566: error: expected primary-expression before ‘const’
make[2]: *** [ToolBase.o] Error 1
make[2]: Leaving directory /home/jgsanders/git_sw/ngs-bits/build-tools-Linux-Release/cppCORE' make[1]: *** [sub-cppCORE-make_first] Error 2 make[1]: Leaving directory /home/jgsanders/git_sw/ngs-bits/build-tools-Linux-Release'
make: *** [build_tools_release] Error 2

Hello,

First, I am using a version of qt greater than 5.5. Here is the output of qmake -v:

QMake version 3.0
Using Qt version 5.6.1 in /usr/lib64

I am getting the following error during the process of running make build_tools_release:

g++ -Wl,-rpath,'$ORIGIN' -Wl,-O1 -o ../../bin/SamplesNGSD main.o -Lngs-bits/src/../bin -lcppCORE -lcppXML -lcppNGS -Lngs-bits/src/../bamtools/lib/ -lbamtools -lz -Lngs-bits/src/SamplesNGSD/../bin -lcppNGSD -lQt5Sql -lQt5Core -lpthread
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `BamTools::BamReader::GetReferenceID(std::__cxx11::basic_string<char, std::char_traits, std::allocator > const&) const'
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `BamTools::BamReader::Open(std::__cxx11::basic_string<char, std::char_traits, std::allocator > const&)'
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `BamTools::BamAlignment::IsValidSize(std::__cxx11::basic_string<char, std::char_traits, std::allocator > const&, std::__cxx11::basic_string<char, std::char_traits, std::allocator > const&) const'
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `BamTools::BamAlignment::FindTag(std::__cxx11::basic_string<char, std::char_traits, std::allocator > const&, char*&, unsigned int const&, unsigned int&) const'
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `BamTools::BamReader::OpenIndex(std::__cxx11::basic_string<char, std::char_traits, std::allocator > const&)'
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `_ZNK8BamTools9BamReader14GetErrorStringB5cxx11Ev'
ngs-bits/src/../bin/libcppNGS.so: undefined reference to `_ZNK8BamTools9BamReader11GetFilenameB5cxx11Ev'
collect2: error: ld returned 1 exit status
make[2]: *** [../../bin/SamplesNGSD] Error 1
make[2]: Leaving directory `ngs-bits/build-tools-Linux-Release/SamplesNGSD'
make[1]: *** [sub-SamplesNGSD-make_first] Error 2
make[1]: Leaving directory `ngs-bits/build-tools-Linux-Release'
make: *** [build_tools_release] Error 2

Any idea what the problem could be?

Hi,
Sorry, I hope this error is something real this time. I'm using GCC 5.4 and qt 5.6.2. I'm running from a GNU Guix build environment (technically on top Ubuntu, but the build is run in chroot so that isn't relevant).

It fails like this:

g++ -c -pipe -O3 -std=gnu++0x -Wall -W -D_REENTRANT -fPIC -DQT_NO_DEBUG_OUTPUT -DQT_NO_DEBUG -DQT_SQL_LIB -DQT_CORE_LIB -I../../src/CnvHunter -I. -I../../src/cppCORE -I../../src/cppXML -I../../src/cppNGS -I../../bamtools/include -I../../src/cppNGSD -I/gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/include -I/gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/include/QtSql -I/gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/include/QtCore -I. -I/gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/mkspecs/linux-g++ -o main.o ../../src/CnvHunter/main.cpp
../../src/CnvHunter/main.cpp: In member function ‘virtual void ConcreteTool::main()’:
../../src/CnvHunter/main.cpp:1068:15: error: ‘pow’ is not a member of ‘std’
       rmsd += std::pow(samples[j]->doc[e]-samples[i]->doc[e], 2);
               ^
../../src/CnvHunter/main.cpp:1068:15: note: suggested alternative:
In file included from /gnu/store/n6nvxlk2j8ysffjh3jphn1k5silnakh6-glibc-2.25/include/features.h:410:0,
                 from /gnu/store/5sv5zy2kgg6iaqyv8zw49w4243j0xkd0-gcc-5.4.0/include/c++/x86_64-unknown-linux-gnu/bits/os_defines.h:39,
                 from /gnu/store/5sv5zy2kgg6iaqyv8zw49w4243j0xkd0-gcc-5.4.0/include/c++/x86_64-unknown-linux-gnu/bits/c++config.h:482,
                 from /gnu/store/5sv5zy2kgg6iaqyv8zw49w4243j0xkd0-gcc-5.4.0/include/c++/cstddef:44,
                 from /gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/include/QtCore/qglobal.h:39,
                 from ../../src/cppCORE/cppCORE_global.h:4,
                 from ../../src/cppCORE/ToolBase.h:4,
                 from ../../src/CnvHunter/main.cpp:1:
/gnu/store/n6nvxlk2j8ysffjh3jphn1k5silnakh6-glibc-2.25/include/bits/mathcalls.h:155:1: note:   ‘pow’
 __MATHCALL_VEC (pow,, (_Mdouble_ __x, _Mdouble_ __y));
 ^
../../src/CnvHunter/main.cpp:1070:19: error: ‘sqrt’ is not a member of ‘std’
      rmsd = 1.0 / std::sqrt(rmsd/exon_indices.count());
                   ^
../../src/CnvHunter/main.cpp:1070:19: note: suggested alternative:
In file included from /gnu/store/n6nvxlk2j8ysffjh3jphn1k5silnakh6-glibc-2.25/include/features.h:410:0,
                 from /gnu/store/5sv5zy2kgg6iaqyv8zw49w4243j0xkd0-gcc-5.4.0/include/c++/x86_64-unknown-linux-gnu/bits/os_defines.h:39,
                 from /gnu/store/5sv5zy2kgg6iaqyv8zw49w4243j0xkd0-gcc-5.4.0/include/c++/x86_64-unknown-linux-gnu/bits/c++config.h:482,
                 from /gnu/store/5sv5zy2kgg6iaqyv8zw49w4243j0xkd0-gcc-5.4.0/include/c++/cstddef:44,
                 from /gnu/store/6fgh94phyq4239grgk8z7yjggldrvwbb-qt-5.6.2/include/QtCore/qglobal.h:39,
                 from ../../src/cppCORE/cppCORE_global.h:4,
                 from ../../src/cppCORE/ToolBase.h:4,
                 from ../../src/CnvHunter/main.cpp:1:
/gnu/store/n6nvxlk2j8ysffjh3jphn1k5silnakh6-glibc-2.25/include/bits/mathcalls.h:158:1: note:   ‘sqrt’
 __MATHCALL (sqrt,, (_Mdouble_ __x));
 ^
make[2]: *** [Makefile:773: main.o] Error 1
make[2]: Leaving directory '/tmp/guix-build-ngs-bits-0-1.c39f1807.drv-0/source/build-tools-Linux-Release/CnvHunter'
make[1]: *** [Makefile:1287: sub-CnvHunter-make_first] Error 2
make[1]: Leaving directory '/tmp/guix-build-ngs-bits-0-1.c39f1807.drv-0/source/build-tools-Linux-Release'
make: *** [Makefile:46: build_tools_release] Error 2

I put the full build log at https://gist.github.com/wwood/3118edc1036124628da6d4d1950c5ccb

I was able to get compilation to succeed by applying this patch:

diff --git a/src/CnvHunter/main.cpp b/src/CnvHunter/main.cpp
index e2edcf8..c4317ca 100644
--- a/src/CnvHunter/main.cpp
+++ b/src/CnvHunter/main.cpp
@@ -11,6 +11,7 @@
 #include <QVector>
 #include <QFileInfo>
 #include <QDir>
+#include <cmath>
 #include "math.h"
 
 class SampleCorrelation;

Perhaps it makes sense to apply that or something similar.

Hey,
There is a problem with ambiguous symbols in the filtering of GSvar and ngs-bits in general
Example:
In one of the latest HGNC updates, the symbol QARS was changed to QARS1. However, sometime in the past there was another gene symbol named QARS with was changed to EPRS.
Thus, currently it is not possible to automatically differentiate between the two.
Now, the HPO-Terms still have the old name of "QARS". However, when trying to filter with Phenotypes (e.g. "Sloping forehead") the gene is completely missing from the filtering (the NA12878 has at least one mutation in this gene:
chr3 49141116 49141116 G A hom)
If a gene can't be mapped to a correct one, maybe the filtering step should show both (all) possibilities instead of none?

Additionally, the file downloaded for the HPO integration uses some old and wrong names, which you might resolve yourself:
COX1 -> MT-CO1
TRNP -> MT-TP
COX2 -> MT-CO2
QARS -> QARS1
ND1 -> MT-ND1

I had to manually adapt the ALL_SOURCES_ALL_FREQUENCIES_diseases_to_genes_to_phenotypes.txt file, otherwise these symbols would not be imported and thus would be missing when filtering the corresponding HPO terms.
Be careful with the adaption, as there are e.g. other genes starting with "COX1" so you can't just change them as easily.

Best,
Alex

Possible implementation:

• Open germline GSvar file
• Select somatic GSvar file for annotation
• Annotate two columns:
  • SNVs/indels (variant, AF, DP)
  • CNVs (variant, AF, DP)

If several germline variants are present, annotate them all.
If several somatic variant are present, annotate them comma-separated.

TODOs:

• Refactor somatic report - put RTF generation into separate class
• Use RTF generation class for germline report

PDF:

• Rückmeldung ZPM ob ok? > ÖHNER
• PDF wird generiert wenn der Befund in die Unterschriftenmappe geht.
• Ordner: Q:\AH\AppsData\GenLab\Mol-Genetik\Exporte\MTB_Somatik-Befunde
  • Zugriffsrechte für GenLab-Nutzer
  • nach erfolgreichem Upload soll PDF-Datei nach Rückfrage gelöscht werden.
    XML:
• Wenn der Befund raus geht und der Fall ans MTB soll, wird der Upload gemacht
• TN-Paar in GSvar öffnen > MTB-Upload Knopf > Dialog
  • Sucht das PDF im GenLab-Export-Ordner - falls nicht da kann der User es manuell hinzufügen
  • Schickt PDF und XML gemeinsam an die API

I was trying to compile ngs-bits and I got into some compilation errors.

I could run make build_3rdparty and everything compiled with no problem. However, when running
make build_tools_release I got the following error:

icpc: command line warning #10155: ignoring option '-l'; argument required
icpc: error #10236: File not found:  'bamtools'
make[2]: *** [../../bin/libcppNGS.so.1.0.0] Error 1
make[2]: Leaving directory `/usr/local/ngs-bits/2.4.1/old/ngs-bits/build-tools-Linux-Release/cppNGS'
make[1]: *** [sub-cppNGS-make_first] Error 2
make[1]: Leaving directory `/usr/local/ngs-bits/2.4.1/old/ngs-bits/build-tools-Linux-Release'
make: *** [build_tools_release] Error 2

The error is clearly due to a space between -l and bamtools. A quick search in ngs-bits directory shows that there are five files with this issue:

src/cppNGSD-TEST/cppNGSD-TEST.pro:37:LIBS += -L$$PWD/../../bamtools/lib/ -l bamtools
src/app_cli.pri:24:LIBS += -L$$PWD/../bamtools/lib/ -l bamtools
src/app_gui.pri:28:LIBS += -L$$PWD/../bamtools/lib/ -l bamtools
src/cppNGS-TEST/cppNGS-TEST.pro:28:LIBS += -L$$PWD/../../bamtools/lib/ -l bamtools
src/cppNGS/cppNGS.pro:30:LIBS += -L$$PWD/../../bamtools/lib/ -l bamtools

Once I removed the space, the code compiled with no errors.

Hi,

I'm running on Ubuntu 16.04
The following packages are installed:
g++ 5.4.0
qt5-default 5.5.1
libqt5xmlpatterns5-dev 5.5.1
libqt5sql5-mysql 5.5.1
cmake 3.5.1

$ make build_3rdparty
cd bamtools && rm -rf bin build lib include src/toolkit/bamtools_version.h
mkdir bamtools/build
cd bamtools/build && cmake .. && make
CMake Error: The source directory "/home/bioinf/Software/ngs-bits-master/bamtools" does not appear to contain CMakeLists.txt.
Specify --help for usage, or press the help button on the CMake GUI.
Makefile:108: recipe for target 'build_3rdparty' failed
make: *** [build_3rdparty] Error 1

Any ideas what went wrong here?

I have run SeqPurge for my targeted sequencing data (17 gene panel).

With the error correction option, I received a core dump error message while there was no issue when I disabled the option.

I am just wondering if there is a way to resolve this issue. Please let me know.

Hi,

When running atropos detect, I am experiences issues for some files; as follows:

Run1Sam03_S3_R1_001.fastq.gz
2019-05-20 12:17:34,008 INFO: This is Atropos 1.1.21 with Python 3.6.7
2019-05-20 12:17:34,011 INFO: Detecting adapters and other potential contaminant sequences based on 12-mers in 10000 reads
2019-05-20 12:17:38,409 ERROR: Unknown error
Traceback (most recent call last):
File "/Volumes/mikami/bio/apps/12.04/sw/atropos/1.1.21/lib/python3.6/site-packages/atropos/util/init.py", line 727, in run_interruptible
func(*args, **kwargs)
File "/Volumes/mikami/bio/apps/12.04/sw/atropos/1.1.21/lib/python3.6/site-packages/atropos/commands/base.py", line 32, in call
self.finish(command_runner.summary, **kwargs)
File "/Volumes/mikami/bio/apps/12.04/sw/atropos/1.1.21/lib/python3.6/site-packages/atropos/commands/detect/init.py", line 481, in finish
for match in self.read1_detector.matches(**kwargs)
File "/Volumes/mikami/bio/apps/12.04/sw/atropos/1.1.21/lib/python3.6/site-packages/atropos/commands/detect/init.py", line 373, in matches
self._filter_and_sort(**kwargs)
File "/Volumes/mikami/bio/apps/12.04/sw/atropos/1.1.21/lib/python3.6/site-packages/atropos/commands/detect/init.py", line 390, in _filter_and_sort
matches = self._get_contaminants()
File "/Volumes/mikami/bio/apps/12.04/sw/atropos/1.1.21/lib/python3.6/site-packages/atropos/commands/detect/init.py", line 617, in _get_contaminants
cur = results[0]
IndexError: list index out of range

My command line is as follows:

for x in R1_001.fastq.gz; do
atropos detect
--no-default-contaminants --no-cache-contaminants
-pe1 ${x%%}_S*R1_001.fastq.gz
-pe2 ${x%%}_SR2_001.fastq.gz
--detector heuristic
--max-reads 1000000
--output ${x%%*}_atropos.txt
done

Would it be clarify the source of this issue?

Thank you.

Dieter

Hello Marc,

After compiling the ngs-bits and starting GSvar on Windows with Qt 5.9.5, I get the follwing error:

Runtime Error! Program ngs-bits-2018_11\bin\GSvar,exe This application has requested the Runtime to terminate it in an unusual way. Please contact the applications's support team for more information

I also tried compiling the most recent version ngs-bits-2018_11-122-gd854460. After starting GSvar and loading a .GSvar file, this error appears:

Uncaught cppCORE exception message: Could not connext ti the NGSD database 'ngsd' file ..\..\src\cppNGSD\NGSD.cpp line: 33

GSvar is working with "NGSD_enabled=false" in the GSvar.ini file

Regards, Winfried

Bugs:

• chrB prefix is upper-case sometimes "CHR9"

Additional features:

• Show the SV size if both breakpoints are on the same chromosome
• Allow copying the current selection, e.g. the genomic coordinates
• Annotate with gene names (for both coordinate ranges)
• Allow filtering by genotype
• Allow filtering by target region (from variant list)
• Allow filtering by phenotype region (from variant list)
• Allow filtering by gene names (from variant list, allow wildcards)
• Show number of variants after filter and overall variant count

Next version:

• Annotate with frequency information from gnomAD SV
• Allow sorting by rows? - maybe...

SeqPurge crashes with Qt Concurrent excecption:

Qt Concurrent has caught an exception thrown from a worker thread.
This is not supported, exceptions thrown in worker threads must be
caught before control returns to Qt Concurrent.
terminate called after throwing an instance of 'ProgrammingException'

Here are the commands that I type:

SeqPurge \
  -in1 /cromwell-executions/quality_de_novo/e859267e-e1dc-4cb7-8bda-53f2fe4c3055/call-trimming_seqpurge/inputs/pipelines/whales/graywhale/GWliver_S1_L001_R1_001.fastq.gz \
  -in2 /cromwell-executions/quality_de_novo/e859267e-e1dc-4cb7-8bda-53f2fe4c3055/call-trimming_seqpurge/inputs/pipelines/whales/graywhale/GWliver_S1_L001_R2_001.fastq.gz \
  -out1 GWliver_S1_L001_R1_001_trimmed.fastq.gz \
  -out2 GWliver_S1_L001_R2_001_trimmed.fastq.gz \
  -ec

I can upload the data for you to check. however it is several GBs

I got error: "Nothing to be done for `../src/tools.pro'." when I executed "make build_tools_release"
And no Makefile generated in build-tools-Linux-Release folder.
Thanks,

--Hi

first command works fine: make build_3rdparty

[100%] Building CXX object src/toolkit/CMakeFiles/bamtools_cmd.dir/bamtools.cpp.o
Linking CXX executable ../../../bin/bamtools

but second failed:

make build_tools_release
rm -rf build-tools-Linux-Release;
mkdir -p build-tools-Linux-Release;
cd build-tools-Linux-Release;
qmake ../src/tools.pro "CONFIG-=debug" "CONFIG+=release" "DEFINES+=QT_NO_DEBUG_OUTPUT";
make;
qmake[1]: Entering directory /save/ngs-bits/build-tools-Linux-Release' qmake[1]: Nothing to be done for ../src/tools.pro'.
qmake[1]: Leaving directory /save/ngs-bits/build-tools-Linux-Release' make[1]: Entering directory /save/ngs-bits/build-tools-Linux-Release'
make[1]: *** No targets specified and no makefile found. Stop.
make[1]: Leaving directory `/save/ngs-bits/build-tools-Linux-Release'
make: *** [build_tools_release] Error 2

what's wrong ?

thank you --

Hi, I'm getting Segmentation fault when using the -threads option. Omitting -threads appears to be working.

Command:
SeqPurge -threads 4 -in1 n1.fastq.gz -in2 n2.fastq.gz -out1 n1.trim.fastq.gz -out2 n2.trim.fastq.gz -out3 singleton > trim.log 2>&1

OS: Centos7

The test data is from here: https://raw.githubusercontent.com/chapmanb/bcbio-nextgen/master/config/examples/cancer-giab-na12878-na24385-getdata.sh

From gdb where:
Core was generated by `/datastore/nextgenout4/seqware-analysis/lmose/software/seqpurge/ngs-bits/bin/Se'.
Program terminated with signal 11, Segmentation fault.
#0 0x00007fda01354b43 in deflate_fast () from /usr/lib64/libz.so.1
Missing separate debuginfos, use: debuginfo-install bzip2-libs-1.0.6-13.el7.x86_64 elfutils-libelf-0.166-2.el7.x86_64 elfutils-libs-0.166-2.el7.x86_64 expat-2.1.0-10.el7_3.x86_64 glib2-2.46.2-4.el7.x86_64 glibc-2.17-157.el7_3.5.x86_64 keyutils-libs-1.5.8-3.el7.x86_64 krb5-libs-1.14.1-27.el7_3.x86_64 libX11-1.6.5-1.el7.x86_64 libXau-1.0.8-2.1.el7.x86_64 libXdamage-1.1.4-4.1.el7.x86_64 libXext-1.3.3-3.el7.x86_64 libXfixes-5.0.3-1.el7.x86_64 libXxf86vm-1.1.4-1.el7.x86_64 libattr-2.4.46-12.el7.x86_64 libcap-2.22-8.el7.x86_64 libcom_err-1.42.9-9.el7.x86_64 libdrm-2.4.74-1.el7.x86_64 libgcc-4.8.5-11.el7.x86_64 libgcrypt-1.5.3-13.el7_3.1.x86_64 libgpg-error-1.12-3.el7.x86_64 libicu-50.1.2-15.el7.x86_64 libmodman-2.0.1-8.el7.x86_64 libpng-1.5.13-7.el7_2.x86_64 libproxy-0.4.11-10.el7.x86_64 libselinux-2.5-6.el7.x86_64 libstdc++-4.8.5-11.el7.x86_64 libxcb-1.12-1.el7.x86_64 libxshmfence-1.2-1.el7.x86_64 mesa-libGL-17.0.1-6.20170307.el7.x86_64 mesa-libglapi-17.0.1-6.20170307.el7.x86_64 openssl-libs-1.0.2k-8.el7.x86_64 pcre-8.32-15.el7_2.1.x86_64 qt5-qtbase-5.6.2-1.el7.x86_64 qt5-qtbase-gui-5.6.2-1.el7.x86_64 qt5-qtxmlpatterns-5.6.2-1.el7.x86_64 systemd-libs-219-30.el7_3.9.x86_64 xz-libs-5.2.2-1.el7.x86_64 zlib-1.2.7-17.el7.x86_64
(gdb) where
#0 0x00007fda01354b43 in deflate_fast () from /usr/lib64/libz.so.1
#1 0x00007fda01355684 in deflate () from /usr/lib64/libz.so.1
#2 0x00007fda0135ee46 in gz_comp () from /usr/lib64/libz.so.1
#3 0x00007fda0135f10a in gzwrite () from /usr/lib64/libz.so.1
#4 0x00007fda0135f2e2 in gzputs () from /usr/lib64/libz.so.1
#5 0x00007fda01868fad in FastqOutfileStream::write (this=0x1df6780, entry=...)
at ../../src/cppNGS/FastqFileStream.cpp:197
#6 0x000000000041045e in AnalysisWorker::run (this=0x1e75610) at ../../src/SeqPurge/AnalysisWorker.cpp:527
#7 0x00007fda00f6af4e in QThreadPoolThread::run() () from /usr/lib64/libQt5Core.so.5
#8 0x00007fda00f6e88d in QThreadPrivate::start(void*) () from /usr/lib64/libQt5Core.so.5
#9 0x00007fda00cb3dc5 in start_thread () from /usr/lib64/libpthread.so.0
#10 0x00007fda001c176d in clone () from /usr/lib64/libc.so.6

Hi,

I get this error when I run the make build_tools_release:

../../src/cppCORE/LinePlot.cpp:9:26: fatal error: QStandardPaths: No such file or directory
#include
^
compilation terminated.
make[2]: *** [LinePlot.o] Error 1

• which information can be obtained via other databases?
• where is it still used in the pipeline?
• is it possible to avoid using genomic coordinates (GRcH37 vs GRcH38)

The somatic INDEL count is a measure for neoantigens like tumor mutation burden and already calculated as a QC parameter

Discuss with MDs how this should be included into the somatic report RTF.

I tried to run SomaticQC but it showed "Only strelka and freebayes are currently supported".
Does the software support Mutect result VCF files?
Thanks,

Hello,
I've been experimenting with PERsim recently, and I was occasionally seeing some weird output reads with read indexes in the reference that didn't match the actual data. After looking at the source code, I think I might have found the problem.

It's in main.cpp, lines 131-135:

std::uniform_int_distribution<int> start_dist(reg.start()-is/2, reg.end()-is/2);
int start = start_dist(gen);
int end = start + is;
if (start<0) start=0;
if (end>reference.lengthOf(chr)) end = reference.lengthOf(chr);

The issue, I think, is that if a value of start is sampled that is < 0 and is is sufficiently small, start + is can also be < 0. In that case, the value of start is later corrected to 0, but the value of end will remain < 0. Thus, you end up with start at the beginning of the reference and end at a nonsense position.

I've not had time to properly confirm this or make a pull request, but I thought it might be useful to report this now in case it is actually a bug.

Thank you!

I was just comparing the match probability formula from your paper:

to the code:

double p = 0.0;
for (int i=matches; i<=count; ++i)
{
    double q = std::pow(0.75, count-i) * std::pow(0.25, i) * fak(count) / fak(matches) / fak(mismatches);
    p += q;
}

and they don't seem to match up. I thought I might just be stupid and didn't recognize a shortcut, so I just calculated a simple example by hand (and reimplemented your formula in python). In this case, n = 5 and k = 3:

# calculation based on published formula
i3 = (120 / (6 * 2)) * (0.25**3) * (0.75**2)
i4 = (120 / (24 * 1)) * (0.25**4) * (0.75**1)
i5 = (120 / (120 * 1)) * (0.25**5) * (0.75**0)
i3+i4+i5 # => 0.103515625

# calculation based on code
p = 0.0
import math
for i in [3,4,5]:
    q = (0.75 ** (5-i)) * (0.25 ** i) * math.factorial(5) / math.factorial(3) / math.factorial(2)
    p += q
print(p) # => 0.126953125

Am I making a stupid mistake here? Or is this a bug? And if so, what implications does that have for the results in your paper?

Allow mapping of transcript identifiers from Ensembl to RefSeq and the other way round.

Integrate into GSvar

Currently, somatic structural variants are chosen by hand.

Like germline SVs, somatic SVs should be imported into NGSD and the user should be able to select a SV for the somatic report configuration.

when I run the following command
./CnvHunter -in xxx/S003_cfdna_depth.tsv xxx/S010_gdna_depth.tsv -out xx/cnvhunter.tsv ,
i always get the following excepthion,
Exception: At least n+1 input files are required! Got 2!
Location : ../../src/CnvHunter/main.cpp:554..............Help!

Dear developers,

using MappingQC as part of a variant calling pipeline, the following error message turns up from time to time.

Might this be something to consider or just a plot that is not being generated properly?

Kind regards,

Thorsten

MappingQC 2018_06
Programming exception: Could not execute python script:
/tmp/cpVB9zzmkx7g1gU5.py
Error message is: Traceback (most recent call last):
File "/tmp/cpVB9zzmkx7g1gU5.py", line 7, in
plt.plot([2.5,7.5,12.5,17.5,22.5,27.5,32.5,37.5,42.5,47.5,52.5,57.5,62.5,67.5,72.5,77.5,82.5,87.5,92.5,97.5,102.5,107.5,112.5,117.5,122.5,127.5,132.5,137.5,142.5,147.5,152.5,157.5,162.5,167.5,172.5,177.5,182.5,187.5,192.5,197.5,202.5,207.5,212.5,217.5,222.5,227.5,232.5,237.5,242.5,247.5,252.5,257.5,262.5,267.5,272.5,277.5,282.5,287.5,292.5,297.5,302.5,307.5,312.5,317.5,322.5,327.5,332.5,337.5,342.5,347.5,352.5,357.5,362.5,367.5,372.5,377.5,382.5,387.5,392.5,397.5,402.5,407.5,412.5,417.5,422.5,427.5,432.5,437.5,442.5,447.5,452.5,457.5,462.5,467.5,472.5,477.5,482.5,487.5,492.5,497.5,502.5,507.5,512.5,517.5,522.5,527.5,532.5,537.5,542.5,547.5,552.5,557.5,562.5,567.5,572.5,577.5,582.5,587.5,592.5,597.5,602.5,607.5,612.5,617.5,622.5,627.5,632.5,637.5,642.5,647.5,652.5,657.5,662.5,667.5,672.5,677.5,682.5,687.5,692.5,697.5,702.5,707.5,712.5,717.5,722.5,727.5,732.5,737.5,742.5,747.5,752.5,757.5,762.5,767.5,772.5,777.5,782.5,787.5,792.5,797.5,802.5,807.5,812.5,817.5,822.5,827.5,832.5,837.5,842.5,847.5,852.5,857.5,862.5,867.5,872.5,877.5,882.5,887.5,892.5,897.5,902.5,907.5,912.5,917.5,922.5,927.5,932.5,937.5,942.5,947.5,952.5,957.5,962.5,967.5,972.5,977.5,982.5,987.5,992.5,997.5],[nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan,nan], label='')
NameError: name 'nan' is not defined

Location : ../../src/cppCORE/LinePlot.cpp:138
This should not happen, please report the error to the developers!

Hi,
we realized there are some inconsistencies in the HPO-Import.
In the "Inheritance terms" you import the name directly as is from the given file and in all other cases, you first run a genes2approved function. Thus you sometimes import the old and sometimes the current symbol.
Is there a specific reason for this?
Interestingly, checking the same term-id in GSvar, the current symbol is shown, whereas the old symbol is written in the database.

Best,
Alex

Hello,

First, thank you for providing the ngs-bits tools! I have been experimenting with PERsim, and I noticed that it sometimes generates reads with insert sizes of 0. Here is an example:

@PERsim:1:ABCDEF:1:mt_genome:3575:3574 1:N:0:AACGTGAT
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTTAAAAAAATACTAGATTAGACAGCTAAGTTAGAAACGTCTAAGAATCCACTGGTGTTATGAATTGAATTGGAACTGGAAAATAGAATTCGTAAGTGACTACGAACCGCAATA
+
AAAAAFFFFFFFGGGGGGFFFFFFFFFFEEEEEEEEEEEEEEEEEEEEEDDDDDDDDDDDDDDDDDDDDDDDDCCCCCCCCCCCCCCCCCCBBBBBBBBBBBBBBBBBBBBBBBBBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Is that a bug, or intended behavior?

Thank you for any help you can provide with this!

The options for exclusion from report "low tumor content", "low copy number" and "high BAF deviation" have not been used yet.

Add option "not protein-altering" and "repeat region".

No change for CNV options!