darcyabjones / pante Goto Github PK
View Code? Open in Web Editor NEWA pipeline for predicting and masking transposable elements in multiple genomes.
License: Apache License 2.0
A pipeline for predicting and masking transposable elements in multiple genomes.
License: Apache License 2.0
Hello Darcy,
I am very glad to use your pipeline for predict fungi TE. I a question that I can put all genomes sequences into genomes file. Then pipeline will automatically run all genomes?
When I run the pipeline, I get the error as following. I do not know the error is from my server or the command?
I use cluster server. Because I do not have root right, I can not use docker. I installed singularity in conda3. Is it right?
Thanks,
Fuyou
WARN: Singularity cache directory has not been defined -- Remote image will be stored in the path: /isilon/saskatoon-rdc/users/fuf/BLgenome/pante/work/singularity
Error executing process > 'getRMRepeatPeps'
Caused by:
Failed to pull singularity image
command: singularity pull --name darcyabjones-default-pante-pante-v0.0.1.img library://darcyabjones/default/pante:pante-v0.0.1 > /dev/null
status : 255
message:
ERROR: pull is only supported for shub URIs
GFF attributes should present a consistent set of fields.
I've tried to use the Dbxref and Ontology_term fields where possible, but lots of TE families/subfamilies can't be represented like this yet.
RepeatMasker/Modeler output taxonomy is just put in Name.
It would be nice to find a good ontology or define a consistent set of fields.
Describe folder structure, gff fields etc when you have time.
Hi Darcy,
I keep running into an error probably with infernal.
Attached is the error message and the 2 input files.
There is only a single entry in the infernal.gff3
file, not sure if that is where the problem stems from.
Cheers,
Johannes
Error executing process > 'tidyInfernalMatches (P9424.ragtag)'
Caused by:
Process `tidyInfernalMatches (P9424.ragtag)` terminated with an error exit status (1)
Command executed:
awk -F '\t' '
BEGIN {OFS="\t"}
{$9=gensub(":", "=", "g", $9); print}
' infernal.gff3 | tidy_infernal_gff.py --go rfam2go --best --source "Rfam" --type nucleotide_match -o tidied.gff3 -
Command exit status:
1
Command output:
(empty)
Command error:
WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
Traceback (most recent call last):
File "/home/ubuntu/pante/bin/tidy_infernal_gff.py", line 137, in <module>
main()
File "/home/ubuntu/pante/bin/tidy_infernal_gff.py", line 79, in main
go = parse_rfam2go(args.go)
File "/home/ubuntu/pante/bin/tidy_infernal_gff.py", line 64, in parse_rfam2go
rfam, go = line.strip().split(">", maxsplit=1)
ValueError: not enough values to unpack (expected 2, got 1)
Work dir:
/data/2021-07-01_kewell_p9424/assembly/circos/Al4_Kewell/work/f0/5ff966c8c334f807a15a35419358e9
Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named `.command.sh`
Hi Darcy,
just tried running panTE over a few new assemblies and keep running into following error:
Error executing process > 'runInfernal (ArTR9571.contigs.racon.medaka.mito)'
Caused by:
Process `runInfernal (ArTR9571.contigs.racon.medaka.mito)` terminated with an error exit status (137)
Command executed:
SIZE=$(grep -v "^>" genome.fasta | sed 's/[[:space:]]//' | tr -d '\n' | wc -c)
TRSIZE=$(perl -E "say ${SIZE} * 2 / 1e6")
cmscan --cpu 1 -Z "${TRSIZE}" --cut_ga --rfam --nohmmonly --tblout "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout" --fmt 2 --clanin rfam/Rfam.clanin rfam/Rfam.cm chunk.fasta > "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out"
grep -v ' = ' "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout" > filtered.txt
infernal-tblout2gff.pl --cmscan --fmt2 --all -E "0.00001" filtered.txt > "cmscan.gff3.unclean"
rm filtered.txt
Command exit status:
137
Command output:
(empty)
Command error:
WARNING: Your kernel does not support swap limit capabilities or the cgroup is not mounted. Memory limited without swap.
.command.sh: line 5: 192 Killed cmscan --cpu 1 -Z "${TRSIZE}" --cut_ga --rfam --nohmmonly --tblout "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout" --fmt 2 --clanin rfam/Rfam.clanin rfam/Rfam.cm chunk.fasta > "ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out"
Work dir:
/data/rabieies_nanopore/pante/work/dc/2bf5bb151efb42939f65b02711bd4d
Tip: you can replicate the issue by changing to the process work dir and entering the command `bash .command.run`
Going to /data/rabieies_nanopore/pante/work/dc/2bf5bb151efb42939f65b02711bd4d
and inspecting what's there:
-rw-rw-r-- 1 ubuntu ubuntu 0 Oct 26 02:10 .command.begin
-rw-rw-r-- 1 ubuntu ubuntu 478 Oct 26 02:19 .command.err
-rw-rw-r-- 1 ubuntu ubuntu 478 Oct 26 02:19 .command.log
-rw-rw-r-- 1 ubuntu ubuntu 0 Oct 26 02:10 .command.out
-rw-rw-r-- 1 ubuntu ubuntu 9.8K Oct 26 02:10 .command.run
-rw-rw-r-- 1 ubuntu ubuntu 682 Oct 26 02:10 .command.sh
-rw-r--r-- 1 root root 0 Oct 26 02:10 .command.trace
-rw-rw-r-- 1 ubuntu ubuntu 3 Oct 26 02:19 .exitcode
-rw-r--r-- 1 root root 27K Oct 26 02:18 ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out
-rw-r--r-- 1 root root 0 Oct 26 02:10 ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout
lrwxrwxrwx 1 ubuntu ubuntu 80 Oct 26 02:10 chunk.fasta -> /data/rabieies_nanopore/pante/work/3d/81ee31298fb5a10019b89a69e6c0d8/out_5.fasta
lrwxrwxrwx 1 ubuntu ubuntu 88 Oct 26 02:10 genome.fasta -> /data/rabieies_nanopore/assembly/07-mitos_fixed/ArTR9571.contigs.racon.medaka.mito.fasta
lrwxrwxrwx 1 ubuntu ubuntu 72 Oct 26 02:10 rfam -> /data/rabieies_nanopore/pante/work/e4/611305d2d34d2cc2e42fd7107feed4/out
And the content of ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.out
:
# cmscan :: search sequence(s) against a CM database
# INFERNAL 1.1.2 (July 2016)
# Copyright (C) 2016 Howard Hughes Medical Institute.
# Freely distributed under a BSD open source license.
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
# query sequence file: chunk.fasta
# target CM database: rfam/Rfam.cm
# database size is set to: 83.7 Mb
# tabular output of hits: ArTR9571.contigs.racon.medaka.mito_rfam_cmscan.tblout
# tabular output format: 2
# model-specific thresholding: GA cutoffs
# Rfam pipeline mode: on [strict filtering]
# clan information read from file: rfam/Rfam.clanin
# HMM-only mode for 0 basepair models: no
# number of worker threads: 1 [--cpu]
# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
Query: ArTR9571_ctg_91 [L=146227]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (292454 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 774489 (0.1089); expected (0.06)
Windows passing local HMM Viterbi filter: 179075 (0.02543); expected (0.02)
Windows passing local HMM Viterbi bias filter: 86597 (0.009734); expected (0.02)
Windows passing local HMM Forward filter: 8129 (0.001162); expected (0.0002)
Windows passing local HMM Forward bias filter: 4513 (0.0006757); expected (0.0002)
Windows passing glocal HMM Forward filter: 2561 (0.0003754); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 2167 (0.0003069); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 2125 (0.0001914); expected (0.0002)
Envelopes passing local CM CYK filter: 615 (4.403e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 54.18u 0.39s 00:00:54.57 Elapsed: 00:00:56.69
//
Query: ArTR9571_ctg_92 [L=145852]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
(1) ! 1.4e-16 83.3 0.0 5S_rRNA 42435 42554 + cm no 0.49 5S ribosomal RNA
(2) ! 1.4e-16 83.3 0.0 5S_rRNA 50848 50729 - cm no 0.49 5S ribosomal RNA
(3) ! 9.9e-16 80.0 0.0 5S_rRNA 60411 60292 - cm no 0.48 5S ribosomal RNA
Hit alignments:
>> 5S_rRNA 5S ribosomal RNA
rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc
---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----
(1) ! 1.4e-16 83.3 0.0 cm 1 119 [] 42435 42554 + .. 0.99 no 0.49
v v v v vv NC
(((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<___ CS
5S_rRNA 1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgGuG 89
:C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG C::C: A :UAAGC::::U+::G:C+G: UAGUA G+UGGGUG
ArTR9571_ctg_92 42435 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuAUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGGUG 42524
***********************************************877**************************************** PP
vv NC
_>>----->>->-->>->>>))))))))): CS
5S_rRNA 90 AcCuCcUGggAAgaccagGugccgCaggcc 119
ACC+C G AA+A:C G:UG::G:A:G:+
ArTR9571_ctg_92 42525 ACCACUAGCGAAUACCCGCUGUUGUAUGUU 42554
****************************** PP
>> 5S_rRNA 5S ribosomal RNA
rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc
---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----
(2) ! 1.4e-16 83.3 0.0 cm 1 119 [] 50848 50729 - .. 0.99 no 0.49
v v v v vv NC
(((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<___ CS
5S_rRNA 1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgGuG 89
:C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG C::C: A :UAAGC::::U+::G:C+G: UAGUA G+UGGGUG
ArTR9571_ctg_92 50848 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuAUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGGUG 50759
***********************************************877**************************************** PP
vv NC
_>>----->>->-->>->>>))))))))): CS
5S_rRNA 90 AcCuCcUGggAAgaccagGugccgCaggcc 119
ACC+C G AA+A:C G:UG::G:A:G:+
ArTR9571_ctg_92 50758 ACCACUAGCGAAUACCCGCUGUUGUAUGUU 50729
****************************** PP
>> 5S_rRNA 5S ribosomal RNA
rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc
---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----
(3) ! 9.9e-16 80.0 0.0 cm 1 119 [] 60411 60292 - .. 0.99 no 0.48
v v v v vv NC
(((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<___ CS
5S_rRNA 1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgGuG 89
:C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG C::C: A :UAAGC::::U+::G:C+G: UAGUA G+U GGUG
ArTR9571_ctg_92 60411 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuAUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGGUG 60322
***********************************************877**************************************** PP
vv NC
_>>----->>->-->>->>>))))))))): CS
5S_rRNA 90 AcCuCcUGggAAgaccagGugccgCaggcc 119
AC +C G AA+A:C G:UG::G:A:G:+
ArTR9571_ctg_92 60321 ACUACUAGCGAAUACCCGCUGUUGUAUGUU 60292
****************************** PP
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (291704 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 726130 (0.0989); expected (0.06)
Windows passing local HMM Viterbi filter: 165058 (0.0222); expected (0.02)
Windows passing local HMM Viterbi bias filter: 100638 (0.01146); expected (0.02)
Windows passing local HMM Forward filter: 6672 (0.0009573); expected (0.0002)
Windows passing local HMM Forward bias filter: 4039 (0.0006008); expected (0.0002)
Windows passing glocal HMM Forward filter: 2333 (0.0003388); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 2053 (0.0002851); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 2006 (0.00018); expected (0.0002)
Envelopes passing local CM CYK filter: 509 (3.693e-05); expected (0.0001)
Total CM hits reported: 3 (3.025e-07); includes 0 truncated hit(s)
# CPU time: 48.81u 0.32s 00:00:49.13 Elapsed: 00:00:50.74
//
Query: ArTR9571_ctg_93 [L=145679]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (291358 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 698962 (0.09389); expected (0.06)
Windows passing local HMM Viterbi filter: 155150 (0.02009); expected (0.02)
Windows passing local HMM Viterbi bias filter: 103846 (0.01182); expected (0.02)
Windows passing local HMM Forward filter: 5808 (0.0008377); expected (0.0002)
Windows passing local HMM Forward bias filter: 3668 (0.0005372); expected (0.0002)
Windows passing glocal HMM Forward filter: 2286 (0.0003309); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 2062 (0.0002906); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 2028 (0.0001859); expected (0.0002)
Envelopes passing local CM CYK filter: 433 (3.168e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 49.48u 0.45s 00:00:49.93 Elapsed: 00:00:51.75
//
Query: ArTR9571_ctg_94 [L=131698]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
(1) ! 1.1e-15 79.9 0.0 5S_rRNA 101863 101982 + cm no 0.49 5S ribosomal RNA
Hit alignments:
>> 5S_rRNA 5S ribosomal RNA
rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc
---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----
(1) ! 1.1e-15 79.9 0.0 cm 1 119 [] 101863 101982 + .. 0.99 no 0.49
v v v v vv NC
(((((((((,,,,<<-<<<<<---<<--<<<<<<______>>-->>>>-.->>---->>>>>-->><<<-<<----<-<<-----<<_ CS
5S_rRNA 1 gccuGcggcCAUAccagcgcgaAagcACcgGauCCCAUCcGaACuCcgA.AguUAAGcgcgcUugggCcagggUAGUAcuagGaUGgG 87
:C:U:C::CCAUA::A::::GAAA: A :G:: CCC+U+CG C::C: :UAAGC::::U+::G:C+G: UAGUA G+UGGG
ArTR9571_ctg_94 101863 ACAUACGACCAUAGGACGUUGAAAACAAGGCUUCCCGUUCGCUCAGCCCuUUUUAAGCAACGUACCGGCGGAUUAGUAGUUAGGUGGG 101950
***********************************************886899*********************************** PP
vv NC
___>>----->>->-->>->>>))))))))): CS
5S_rRNA 88 uGAcCuCcUGggAAgaccagGugccgCaggcc 119
UGACC+C G AA+A:C G:UG::G:A:G:+
ArTR9571_ctg_94 101951 UGACCACUAGCGAAUACCCGCUGUUGUAUGUU 101982
******************************** PP
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (263396 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 592710 (0.08444); expected (0.06)
Windows passing local HMM Viterbi filter: 133762 (0.01824); expected (0.02)
Windows passing local HMM Viterbi bias filter: 102230 (0.01299); expected (0.02)
Windows passing local HMM Forward filter: 4788 (0.0007667); expected (0.0002)
Windows passing local HMM Forward bias filter: 3335 (0.0005428); expected (0.0002)
Windows passing glocal HMM Forward filter: 1904 (0.0002984); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1717 (0.0002556); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1697 (0.0001675); expected (0.0002)
Envelopes passing local CM CYK filter: 354 (2.61e-05); expected (0.0001)
Total CM hits reported: 1 (1.117e-07); includes 0 truncated hit(s)
# CPU time: 40.34u 0.53s 00:00:40.87 Elapsed: 00:00:42.33
//
Query: ArTR9571_ctg_95 [L=128392]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (256784 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 601403 (0.0909); expected (0.06)
Windows passing local HMM Viterbi filter: 134879 (0.01973); expected (0.02)
Windows passing local HMM Viterbi bias filter: 90830 (0.01173); expected (0.02)
Windows passing local HMM Forward filter: 5473 (0.0008914); expected (0.0002)
Windows passing local HMM Forward bias filter: 3429 (0.0005684); expected (0.0002)
Windows passing glocal HMM Forward filter: 1958 (0.0003267); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1756 (0.000285); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1735 (0.0001802); expected (0.0002)
Envelopes passing local CM CYK filter: 430 (3.534e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 44.91u 0.51s 00:00:45.41 Elapsed: 00:00:46.77
//
Query: ArTR9571_ctg_96 [L=126991]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (253982 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 622243 (0.09705); expected (0.06)
Windows passing local HMM Viterbi filter: 139745 (0.02119); expected (0.02)
Windows passing local HMM Viterbi bias filter: 88235 (0.01159); expected (0.02)
Windows passing local HMM Forward filter: 6124 (0.001047); expected (0.0002)
Windows passing local HMM Forward bias filter: 3949 (0.0006942); expected (0.0002)
Windows passing glocal HMM Forward filter: 1892 (0.0003211); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1671 (0.0002712); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1646 (0.0001713); expected (0.0002)
Envelopes passing local CM CYK filter: 360 (2.954e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 41.42u 0.28s 00:00:41.70 Elapsed: 00:00:42.93
//
Query: ArTR9571_ctg_97 [L=125463]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
(1) ! 4.8e-25 94.9 0.0 Afu_309 108593 108324 - cm no 0.58 A. fumigatus sRNA Afu_309
Hit alignments:
>> Afu_309 A. fumigatus sRNA Afu_309
rank E-value score bias mdl mdl from mdl to seq from seq to acc trunc gc
---- --------- ------ ----- --- -------- -------- ----------- ----------- ---- ----- ----
(1) ! 4.8e-25 94.9 0.0 cm 1 322 [] 108593 108324 - .. 0.80 no 0.58
vv v v vv NC
:::::::::::::::::((((((((<<<<<<-<<<<<<<<<<<<<<<<<-<<<-<<<<____>>>>>>>->>>>>>->>->.>>>>-- CS
Afu_309 1 aucAauagAAcAaacaCaGAuCUGUGuCCAGCgcuCCugugCcagccgguggcccgccUUugggcggccUccggcuGgGUc.acgGUU 87
+AA ::::CUGUG CCAG ::UCCUG::C: C UUGGG G:GU: :CGGU
ArTR9571_ctg_97 108593 UGUAA------------CAGCCUGUG-CCAGUUUUCCUGUCCACC------------CCUUGGG------------GUGUGuUCGGUC 108543
*9999............********8.68**********977722............3444432............25555269**** PP
v v NC
>>>>->>>>>>,,,,,,,.<<<.<<--<<<-<<<________________>>>->>>------>>>>>)))))))),,,,,,,,,,<< CS
Afu_309 88 GagcGCUGGaCAGUUCGA.CGa.ccuAuGgAgcCAUCaauuuucuUuuAUGguguCaAUUUCCgguCGACAGaUCuCAGAuugAaugc 173
GA::GCUGG CAGU CG CG: C AUGGA::C UC + G::GUCAAU UCCG :CGACAG::::CAGA +A U
ArTR9571_ctg_97 108542 GAGAGCUGG-CAGUCCGUuCGUgACCAUGGAGCCGUCUUGAG---CAGUGGACGUCAAUAUCCGAACGACAGGCUGCAGAGCAAGU-- 108461
*******86.8****9965787459*********99988776...44444*******************************98866.. PP
v v v v v NC
<---<<<<<<---------<<<<--<<<<<<.<<____>>-..>>>>>>>>>>------>>>>>>->>>,,,,<<<<<<<<------- CS
Afu_309 174 cgacaccggGuGUuaacuucgcCUUgagcuC.CCguuuGGU..GagcucGgcggGAuagCccgguaggcuGaaGgCGcCAuAUUCCaa 258
:C::G UG U CC UGAG:UC CCG ++GGU GA:CUCG G AG C::G: A G: :C :AUUCC+
ArTR9571_ctg_97 108460 --CGGCGCGUUGCUGGAA-G-CC-UGAGUUCgCCGGAAGGUuuGAGCUCG--GUGGAAGGCGCGUG---CCAGGCAGACUGAUUCCUG 108383
..3355555555444443.3.34.67777775889999888457777775..45555555555553...67889999*********** PP
v v v v v NC
-<<<<<-.-<<<-----<<<<___>>>>----->>>->>>>>------>>>>>-->>>::::::: CS
Afu_309 259 uuCCcuU.ugCCGauUuGgCcGUCgGcCgaUGAGGcUagGGaaaAACCaUGgCuaGcCaACAUuu 322
UUCCC U UGC U+G:CCGUCGG:C AUGA GCU GGGA AAACC: G: :C ACAU+U
ArTR9571_ctg_97 108382 UUCCCUUuUGC----UAGACCGUCGGUCCAUGACGCUUGGGACAAACCCAGUU--GGCUACAUAU 108324
*****862577....5***********************************98..9********* PP
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (250926 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 552504 (0.0817); expected (0.06)
Windows passing local HMM Viterbi filter: 123778 (0.01734); expected (0.02)
Windows passing local HMM Viterbi bias filter: 99084 (0.01324); expected (0.02)
Windows passing local HMM Forward filter: 4292 (0.0006762); expected (0.0002)
Windows passing local HMM Forward bias filter: 3126 (0.0004941); expected (0.0002)
Windows passing glocal HMM Forward filter: 1742 (0.0002881); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1615 (0.0002631); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1608 (0.0001676); expected (0.0002)
Envelopes passing local CM CYK filter: 321 (2.679e-05); expected (0.0001)
Total CM hits reported: 1 (2.637e-07); includes 0 truncated hit(s)
# CPU time: 39.20u 0.33s 00:00:39.53 Elapsed: 00:00:40.61
//
Query: ArTR9571_ctg_98 [L=124139]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (248278 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 560834 (0.08582); expected (0.06)
Windows passing local HMM Viterbi filter: 124290 (0.01796); expected (0.02)
Windows passing local HMM Viterbi bias filter: 93460 (0.01259); expected (0.02)
Windows passing local HMM Forward filter: 4514 (0.0007523); expected (0.0002)
Windows passing local HMM Forward bias filter: 3152 (0.0005322); expected (0.0002)
Windows passing glocal HMM Forward filter: 1929 (0.0003276); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1762 (0.0002931); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1737 (0.0001891); expected (0.0002)
Envelopes passing local CM CYK filter: 404 (3.413e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 45.59u 0.51s 00:00:46.10 Elapsed: 00:00:47.36
//
Query: ArTR9571_ctg_99 [L=124046]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (248092 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 560790 (0.08566); expected (0.06)
Windows passing local HMM Viterbi filter: 124258 (0.01803); expected (0.02)
Windows passing local HMM Viterbi bias filter: 92471 (0.01241); expected (0.02)
Windows passing local HMM Forward filter: 4612 (0.0007524); expected (0.0002)
Windows passing local HMM Forward bias filter: 3140 (0.0005153); expected (0.0002)
Windows passing glocal HMM Forward filter: 1837 (0.0003054); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1685 (0.000273); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1671 (0.0001784); expected (0.0002)
Envelopes passing local CM CYK filter: 342 (2.733e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 40.24u 0.47s 00:00:40.71 Elapsed: 00:00:42.27
//
Query: ArTR9571_ctg_100 [L=123211]
Hit scores:
rank E-value score bias modelname start end mdl trunc gc description
---- --------- ------ ----- --------- ------ ------ --- ----- ---- -----------
[No hits detected that satisfy reporting thresholds]
Hit alignments:
[No hits detected that satisfy reporting thresholds]
Internal CM pipeline statistics summary:
----------------------------------------
Query sequence(s): 1 (246422 residues searched)
Query sequences re-searched for truncated hits: 1 (666.4 residues re-searched, avg per model)
Target model(s): 4070 (480450 consensus positions)
Windows passing local HMM SSV filter: 560535 (0.08603); expected (0.06)
Windows passing local HMM Viterbi filter: 124731 (0.01831); expected (0.02)
Windows passing local HMM Viterbi bias filter: 95103 (0.01287); expected (0.02)
Windows passing local HMM Forward filter: 4099 (0.0006765); expected (0.0002)
Windows passing local HMM Forward bias filter: 2824 (0.0004691); expected (0.0002)
Windows passing glocal HMM Forward filter: 1745 (0.0002895); expected (0.0002)
Windows passing glocal HMM Forward bias filter: 1587 (0.0002563); expected (0.0002)
Envelopes passing glocal HMM envelope defn filter: 1567 (0.000165); expected (0.0002)
Envelopes passing local CM CYK filter: 362 (3.044e-05); expected (0.0001)
Total CM hits reported: 0 (0); includes 0 truncated hit(s)
# CPU time: 40.37u 0.46s 00:00:40.83 Elapsed: 00:00:41.94
//
I restarted it a few times and it keeps crashing with the same error on all of the assemblies, just seems a matter of which one it picks first. Sometimes the .out
file is empty.
It would be lovely to have steps to count frequencies of families, proportion of genome covered etc.
Maybe also counts within OcculterCut regions would be good too.
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.