zyxue / biogrinder Goto Github PK

When no error model is specified the sequences are different than the template.

The template is:

test1
GTCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCGAATCA

Attached is the alignment with muscle after running:
grinder -rf test1.fasta -tr 50 -rd 100 -bn ${i}_none

Hello,

I've been trying to install Grinder on my macOS machine but I'am struggling with Bio::SeqIO module.

After "installing" and running the command grinder-h I get this:

Can't locate Bio/SeqIO.pm in @inc (you may need to install the Bio::SeqIO module) (@inc contains: /Users/imac/opt/anaconda3/bin /Users/imac/opt/anaconda3/lib/site_perl/5.26.2/darwin-thread-multi-2level /Users/imac/opt/anaconda3/lib/site_perl/5.26.2 /Users/imac/opt/anaconda3/lib/5.26.2/darwin-thread-multi-2level /Users/imac/opt/anaconda3/lib/5.26.2 .) at /Users/imac/opt/anaconda3/lib/site_perl/5.26.2/Grinder.pm line 11.
BEGIN failed--compilation aborted at /Users/imac/opt/anaconda3/lib/site_perl/5.26.2/Grinder.pm line 11.
Compilation failed in require at /Users/imac/opt/anaconda3/bin/grinder line 24.
BEGIN failed--compilation aborted at /Users/imac/opt/anaconda3/bin/grinder line 24.

The make command gives the following

[…]
9 dependencies missing (Graph::Directed,LWP::UserAgent,List::MoreUtils,Test::Memory::Cycle,XML::DOM,XML::LibXML,XML::LibXML::Reader,XML::Parser::PerlSAX,XML::Twig); additionally test harness failed
/usr/bin/make test -- NOT OK
//hint// to see the cpan-testers results for installing this module, try:
reports CJFIELDS/BioPerl-1.7.8.tar.gz
*** Bio::Root::Version installation failed.
*** Installing Bio::Location::Split...
Running install for module 'Bio::Location::Split'
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been unwrapped into directory /Users/imac/.cpan/build/BioPerl-1.7.8-6
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been prepared
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been made
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been tested within this command
*** Bio::Location::Split installation failed.
*** Installing Bio::Root::Root...
Running install for module 'Bio::Root::Root'
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been unwrapped into directory /Users/imac/.cpan/build/BioPerl-1.7.8-6
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been prepared
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been made
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been tested within this command
*** Bio::Root::Root installation failed.
*** Installing Bio::SeqIO...
Running install for module 'Bio::SeqIO'
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been unwrapped into directory /Users/imac/.cpan/build/BioPerl-1.7.8-6
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been prepared
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been made
CJFIELDS/BioPerl-1.7.8.tar.gz
Has already been tested within this command
*** Bio::SeqIO installation failed.
*** Installing Math::Random::MT...
Running install for module 'Math::Random::MT'
Checksum for /Users/imac/.cpan/sources/authors/id/F/FA/FANGLY/Math-Random-MT-1.17.tar.gz ok
Configuring F/FA/FANGLY/Math-Random-MT-1.17.tar.gz with Makefile.PL
Checking if your kit is complete...
Looks good
Generating a Unix-style Makefile
Writing Makefile for Math::Random::MT
Writing MYMETA.yml and MYMETA.json
FANGLY/Math-Random-MT-1.17.tar.gz
/Users/imac/opt/anaconda3/bin/perl Makefile.PL -- OK
Running make for F/FA/FANGLY/Math-Random-MT-1.17.tar.gz
cp MT.pm blib/lib/Math/Random/MT.pm
Running Mkbootstrap for MT ()
chmod 644 "MT.bs"
"/Users/imac/opt/anaconda3/bin/perl" -MExtUtils::Command::MM -e 'cp_nonempty' -- MT.bs blib/arch/auto/Math/Random/MT/MT.bs 644
"/Users/imac/opt/anaconda3/bin/perl" "/Users/imac/opt/anaconda3/lib/5.26.2/ExtUtils/xsubpp" -typemap '/Users/imac/opt/anaconda3/lib/5.26.2/ExtUtils/typemap' -typemap '/Users/imac/.cpan/build/Math-Random-MT-1.17-4/typemap' MT.xs > MT.xsc
mv MT.xsc MT.c
x86_64-apple-darwin13.4.0-clang -c -fno-common -DPERL_DARWIN -no-cpp-precomp -mmacosx-version-min=10.9 -fno-strict-aliasing -pipe -fstack-protector-strong -DPERL_USE_SAFE_PUTENV -O3 -DVERSION="1.17" -DXS_VERSION="1.17" -fPIC --sysroot=/opt/MacOSX10.9.sdk "-I/Users/imac/opt/anaconda3/lib/5.26.2/darwin-thread-multi-2level/CORE" MT.c
/bin/sh: x86_64-apple-darwin13.4.0-clang: command not found
make[1]: *** [MT.o] Error 127
FANGLY/Math-Random-MT-1.17.tar.gz
/usr/bin/make -- NOT OK
*** Math::Random::MT installation failed.
*** Module::AutoInstall installation finished.
cp lib/Grinder/Database.pm blib/lib/Grinder/Database.pm
cp lib/Grinder/KmerCollection.pm blib/lib/Grinder/KmerCollection.pm
cp lib/Bio/PrimarySeqI.pm blib/lib/Bio/PrimarySeqI.pm
cp lib/Bio/PrimarySeq.pm blib/lib/Bio/PrimarySeq.pm
cp lib/Bio/SeqFeature/Amplicon.pm blib/lib/Bio/SeqFeature/Amplicon.pm
cp lib/Bio/DB/Fasta.pm blib/lib/Bio/DB/Fasta.pm
cp lib/Grinder.pm blib/lib/Grinder.pm
cp lib/Bio/Seq/SimulatedRead.pm blib/lib/Bio/Seq/SimulatedRead.pm
cp lib/Bio/Seq/SeqFastaSpeedFactory.pm blib/lib/Bio/Seq/SeqFastaSpeedFactory.pm
cp lib/Bio/Tools/IUPAC.pm blib/lib/Bio/Tools/IUPAC.pm
cp lib/Bio/DB/IndexedBase.pm blib/lib/Bio/DB/IndexedBase.pm
cp lib/Bio/SeqFeature/SubSeq.pm blib/lib/Bio/SeqFeature/SubSeq.pm
cp lib/Bio/SeqFeature/Primer.pm blib/lib/Bio/SeqFeature/Primer.pm
cp lib/Bio/Tools/AmpliconSearch.pm blib/lib/Bio/Tools/AmpliconSearch.pm
cp utils/average_genome_size blib/script/average_genome_size
"/Users/imac/opt/anaconda3/bin/perl" "-Iinc" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/average_genome_size
cp utils/change_paired_read_orientation blib/script/change_paired_read_orientation
"/Users/imac/opt/anaconda3/bin/perl" "-Iinc" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/change_paired_read_orientation
cp script/grinder blib/script/grinder
"/Users/imac/opt/anaconda3/bin/perl" "-Iinc" -MExtUtils::MY -e 'MY->fixin(shift)' -- blib/script/grinder
Manifying 2 pod documents
Manifying 13 pod documents

I don't know if it is related but Bio module is installed in python and it can import SeqIO.
Any help is appreciated.

Najoua

Hello,

Great work, i appreciate it so much but i am having a little problem. Eventho i ve tried many options i simply can not get the abundance that i specify. I.E. my abundance file looks like below, i should get an equal distribution right? Somehow the grinder-ranks.txt shows the abundance correct but in my grinder-reads.fa file does not yield equal distribution nor never gives me the specified distribution. I am posting the command that i am using altho I have tried it with many parameters . What am i doing wrong in here? Please help

grinder -reference_file 16Sncbi.fasta -abundance_file abundance.txt
abundance.txt looks like below
NR_116675.1 0.1
NR_163665.1 0.1
NR_152690.1 0.1
NR_163664.1 0.1
NR_163663.1 0.1
NR_163662.1 0.1
NR_163661.1 0.1
NR_163660.1 0.1
NR_163659.1 0.1
NR_163658.1 0.1

Hi,

I'm trying to simulate a long reference sequence (about 250 megabases) that I would like to keep compressed. However, I was getting errors when trying to use the gzipped file.

MSG: The sequence does not appear to be FASTA format (lacks a descriptor line '>')

I tried to instead zcat the gzipped file as a variable and pass that to Grinder in lieu of an actual file, and I tried to gunzip the file and use stdin in lieu of an actual file. I couldn't get either approach to work. Are there any plans soon to allow compressed files as grinder input, or do you have other suggestions?

This tool is awesome, been simulating dna and rna-seq data for some time now with it. Any chance there will be a version supporting multithread?