sshen8 / peglit Goto Github PK
View Code? Open in Web Editor NEWAutomatically identify non-interfering nucleotide linkers between a pegRNA and 3' motif
Home Page: https://peglit.liugroup.us
License: Other
Automatically identify non-interfering nucleotide linkers between a pegRNA and 3' motif
Home Page: https://peglit.liugroup.us
License: Other
The setup.py file asks for Python >= 3.6, but imports require >= 3.8.
math.prod(iterable, *, start=1)
Calculate the product of all the elements in the input iterable. The default start value for the product is 1.When the iterable is empty, return the start value. This function is intended specifically for use with numeric values and may reject non-numeric types.
New in version 3.8.
Hi @sshen8 ,
After calculating the linker sequences, I found the several output lines include a tag said '+ Significant motif:pegRNA interaction predicted' like below,
so how could I chose the output linker sequence, which one is better?
Thanks in advances,
Yung-Chien
I pulled some of the test data and ran this command...
peglit GGCCCAGACTGAGCACGTGA,GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC,TGGAGGAAGCAGGGCTTCCTTTCCTCTGCCATCACTTATCGTCGTCATCCTTGTAATC,CGTGCTCAGTCTG,CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA --linker-pattern NN
My commandline runs this output then just stalls here for a long time.
pegRNA: 0%| | 0/1 [00:00<?, ?it/s]
Repeats: 0%| | 0/10 [00:00<?, ?it/s]
Steps: 5%|██▎ | 12/250 [00:20<00:09, 25.32it/s]
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.