matthewhiggins2017 / bioconda-primedrpa Goto Github PK

Hi Dear seniors.

I am using PrimedRPA to create and filter RPA primers and probes on my Ubuntu 16.04 LTS
I therefore followed PrimedRPA Walkthrough available on
https://github.com/MatthewHiggins2017/bioconda-PrimedRPA/wiki/WalkThrough.
I previously installed miniconda3 on my Linux (Ubuntu 16.04) and ran the different command lines recommended in that Step-by-step procedure. Furthermore, I checked out the different examples given by the author.
Unfortunately, I encountered the following challenge :

mifer@fmichodigni:/Desktop/Nasser_RPA$ PrimedRPA PrimedRPA_Parameters.txt
PrimedRPA: command not found
mifer@fmichodigni:/Desktop/Nasser_RPA$

This my home Directory:
mifer@fmichodigni:~/Desktop/Nasser_RPA$ ls
EF179169.1?report=fasta PrimedRPA-master
GCF_000896435.1_ViralProj76727_genomic.fna PrimedRPA_Parameters.txt

Kindly assist me to find out the right command line or advise on this matter.
I look forward to learning from.
Cheers,
Noutin Fernand, PhD fellow in Molecular Biology & Biotechnology.

Generating Alignment Summary
Generating Primer/Probe Binding Site DataFrame
multiprocessing.pool.RemoteTraceback:
"""
Traceback (most recent call last):
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/multiprocessing/pool.py", line 121, in worker
result = (True, func(*args, **kwds))
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/multiprocessing/pool.py", line 47, in starmapstar
return list(itertools.starmap(args[0], args[1]))
File "/Users/yonghuiwu/Desktop/bioconda-PrimedRPA-master/PrimedRPA", line 555, in IndentifyingAndFilteringOligos
MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBool = BlastnBackgroundCheck(NucleotideSeq, AllParameter)
File "/Users/yonghuiwu/Desktop/bioconda-PrimedRPA-master/PrimedRPA", line 232, in BlastnBackgroundCheck
blastnoutdf = blastnoutdf.sort_values(by=['Advanced Cross Reactivity Percentage'],ascending=False)
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/site-packages/pandas/util/_decorators.py", line 311, in wrapper
return func(*args, **kwargs)
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/site-packages/pandas/core/frame.py", line 6259, in sort_values
k = self._get_label_or_level_values(by, axis=axis)
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/site-packages/pandas/core/generic.py", line 1779, in _get_label_or_level_values
raise KeyError(key)
KeyError: 'Advanced Cross Reactivity Percentage'
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
File "/Users/yonghuiwu/Desktop/bioconda-PrimedRPA-master/PrimedRPA", line 1046, in
CheckingAlignedOutputFile(AllParameter)
File "/Users/yonghuiwu/Desktop/bioconda-PrimedRPA-master/PrimedRPA", line 820, in CheckingAlignedOutputFile
PotentialPrimerProbeOut = pool.starmap(IndentifyingAndFilteringOligos,PrimerProbeCheckParallelInput)
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/multiprocessing/pool.py", line 276, in starmap
return self._map_async(func, iterable, starmapstar, chunksize).get()
File "/Library/Frameworks/Python.framework/Versions/3.7/lib/python3.7/multiprocessing/pool.py", line 657, in get
raise self._value
KeyError: 'Advanced Cross Reactivity Percentage'

while running PrimedRPA (downloaded from Bioconda) we are encountering following error

$ PrimedRPA --InputFile HBV.fasta --RunID HBV_1



-------------------------------------------
----------------PrimedRPA------------------
-----Finding RPA Primer and Probe Sets-----
-------------Higgins M et al.--------------
-------------------------------------------


Generating Alignment Summary
multiprocessing.pool.RemoteTraceback: 
"""
Traceback (most recent call last):
  File "/home/obront/miniforge3/envs/primedrpa/lib/python3.8/multiprocessing/pool.py", line 125, in worker
    result = (True, func(*args, **kwds))
  File "/home/obront/miniforge3/envs/primedrpa/lib/python3.8/multiprocessing/pool.py", line 51, in starmapstar
    return list(itertools.starmap(args[0], args[1]))
  File "/home/obront/miniforge3/envs/primedrpa/bin/PrimedRPA", line 438, in CreatingInputHomologyDF
    AlignedDF = AlignedDF.append({'Index_Pos':seqindex,'Nucleotide':MostCommonN,'IdentityScore':NRepresentation},ignore_index=True)
  File "/home/obront/miniforge3/envs/primedrpa/lib/python3.8/site-packages/pandas/core/generic.py", line 5989, in __getattr__
    return object.__getattribute__(self, name)
AttributeError: 'DataFrame' object has no attribute 'append'
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
  File "/home/obront/miniforge3/envs/primedrpa/bin/PrimedRPA", line 1046, in <module>
    CheckingAlignedOutputFile(AllParameter)
  File "/home/obront/miniforge3/envs/primedrpa/bin/PrimedRPA", line 806, in CheckingAlignedOutputFile
    AlignedDFMultiThreadOupt = pool.starmap(CreatingInputHomologyDF,MTDFOVI)
  File "/home/obront/miniforge3/envs/primedrpa/lib/python3.8/multiprocessing/pool.py", line 372, in starmap
    return self._map_async(func, iterable, starmapstar, chunksize).get()
  File "/home/obront/miniforge3/envs/primedrpa/lib/python3.8/multiprocessing/pool.py", line 771, in get
    raise self._value
AttributeError: 'DataFrame' object has no attribute 'append'

looks like this is related to issue mentioned here

https://stackoverflow.com/questions/75956209/error-dataframe-object-has-no-attribute-append

Hi, while I was following the step-by-step walkthrough, I encountered the following error:

Generating Alignment Summary
Traceback (most recent call last):
File "", line 1, in
File "/Users/Benz/opt/miniconda3/lib/python3.8/multiprocessing/spawn.py", line 116, in spawn_main
exitcode = _main(fd, parent_sentinel)
File "/Users/Benz/opt/miniconda3/lib/python3.8/multiprocessing/spawn.py", line 125, in _main
prepare(preparation_data)
File "/Users/Benz/opt/miniconda3/lib/python3.8/multiprocessing/spawn.py", line 236, in prepare
_fixup_main_from_path(data['init_main_from_path'])
File "/Users/Benz/opt/miniconda3/lib/python3.8/multiprocessing/spawn.py", line 287, in _fixup_main_from_path
main_content = runpy.run_path(main_path,
File "/Users/Benz/opt/miniconda3/lib/python3.8/runpy.py", line 265, in run_path
return _run_module_code(code, init_globals, run_name,
File "/Users/Benz/opt/miniconda3/lib/python3.8/runpy.py", line 97, in _run_module_code
_run_code(code, mod_globals, init_globals,
File "/Users/Benz/opt/miniconda3/lib/python3.8/runpy.py", line 87, in _run_code
exec(code, run_globals)
File "/Users/Benz/opt/miniconda3/bin/PrimedRPA", line 1046, in
CheckingAlignedOutputFile(AllParameter)
File "/Users/Benz/opt/miniconda3/bin/PrimedRPA", line 807, in CheckingAlignedOutputFile
MergedAlignedDF = pd.concat(AlignedDFMultiThreadOupt).reset_index().drop(['index'],axis=1)
UnboundLocalError: local variable 'AlignedDFMultiThreadOupt' referenced before assignment

 I already made sure that I installed the latest version of all dependencies (including samtools) and have tried full anaconda, mini anaconda, and using virtual environment. Does anyone have an idea where I might have gone wrong? Thank you in advance.

Hello! I wanted to reach out to see if there was any way I could get help in figuring out the solution to an issue that I am having in being able to run PrimedRPA. I followed the basic steps of installing conda, as well as creating an environment specifically for PrimedRPA. However, when I execute the program using the files to validate my installation, this string of errors is continually returned to the terminal:

`-------------------------------------------
----------------PrimedRPA------------------
-----Finding RPA Primer and Probe Sets-----
-------------Higgins M et al.--------------

Generating Alignment Summary
Traceback (most recent call last):
File "", line 1, in
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 116, in spawn_main
exitcode = _main(fd, parent_sentinel)
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 125, in _main
prepare(preparation_data)
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 236, in prepare
Traceback (most recent call last):
File "", line 1, in
_fixup_main_from_path(data['init_main_from_path'])
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 287, in _fixup_main_from_path
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 116, in spawn_main
main_content = runpy.run_path(main_path,
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/runpy.py", line 265, in run_path
exitcode = _main(fd, parent_sentinel)
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 125, in _main
prepare(preparation_data)
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 236, in prepare
_fixup_main_from_path(data['init_main_from_path'])
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/multiprocessing/spawn.py", line 287, in _fixup_main_from_path
main_content = runpy.run_path(main_path,
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/runpy.py", line 265, in run_path
return _run_module_code(code, init_globals, run_name,
return _run_module_code(code, init_globals, run_name,
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/runpy.py", line 97, in _run_module_code
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/runpy.py", line 97, in _run_module_code
_run_code(code, mod_globals, init_globals,
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/runpy.py", line 87, in _run_code
_run_code(code, mod_globals, init_globals,
File "/Users/inletant/miniconda3/envs/RPAenv/lib/python3.8/runpy.py", line 87, in _run_code
exec(code, run_globals)
File "/Users/inletant/miniconda3/envs/RPAenv/bin/PrimedRPA", line 1046, in
exec(code, run_globals)
File "/Users/inletant/miniconda3/envs/RPAenv/bin/PrimedRPA", line 1046, in
CheckingAlignedOutputFile(AllParameter)
File "/Users/inletant/miniconda3/envs/RPAenv/bin/PrimedRPA", line 807, in CheckingAlignedOutputFile
CheckingAlignedOutputFile(AllParameter)
File "/Users/inletant/miniconda3/envs/RPAenv/bin/PrimedRPA", line 807, in CheckingAlignedOutputFile
MergedAlignedDF = pd.concat(AlignedDFMultiThreadOupt).reset_index().drop(['index'],axis=1)
UnboundLocalError: local variable 'AlignedDFMultiThreadOupt' referenced before assignment
MergedAlignedDF = pd.concat(AlignedDFMultiThreadOupt).reset_index().drop(['index'],axis=1)
UnboundLocalError: local variable 'AlignedDFMultiThreadOupt' referenced before assignment`

I'm not sure exactly whats going on, and truth be told I have only basic experience in utilizing Python and I have tried to reinstall miniconda, bioconda, and PrimedRPA a few times. Any help would be greatly appreciated, and thank you in advance!

I have set of files of sequences aligned in MEGA. I want to design RPA primers through Primed RPA. Please guide

Hi,
Stumbling on the walk through here: after copying new parameters to file program doesn't recognise the file path for Step 3.
Have re-started terminal, restarted machine and checked all file paths within the Parameters file.
Any ideas please?

(base) jeff@UBU-CND7483XVZ:$ cd ./Walk_Through_RPA_Primers/
(base) jeff@UBU-CND7483XVZ:/Walk_Through_RPA_Primers$ ls -l
total 1704
-rw-r--r-- 1 jeff jeff 7478 May 15 2015 GCF_000896435.1_ViralProj76727_genomic.fna
-rw-r--r-- 1 jeff jeff 94163 May 19 12:06 HPV_Run_1_Alignment_Summary.csv
-rw-r--r-- 1 jeff jeff 237945 May 19 12:06 HPV_Run_1_Output_Sets.csv
-rw-r--r-- 1 jeff jeff 1393632 May 19 12:06 HPV_Run_1_PrimedRPA_Oligo_Binding_Sites.csv
-rw-r--r-- 1 jeff jeff 2378 May 19 12:16 PrimedRPA_Parameters.txt
(base) jeff@UBU-CND7483XVZ:~/Walk_Through_RPA_Primers$ PrimedRPA PrimedRPA_Parameters.txt

----------------PrimedRPA------------------
-----Finding RPA Primer and Probe Sets-----
-------------Higgins M et al.--------------

Parameters File Could Not Be Opened
Check File Path.
PLease run PrimedRPA --help to see valid options

hello,
i would like to know if it is possible to know the solution for this issue.
i installed the PrimedRPA tool following the installtion guidelines:

git clone https://github.com/MatthewHiggins2017/bioconda-PrimedRPA.git
cd ./bioconda-PrimedRPA
conda env create --file=PrimedRPA.yml
conda activate RPA
python setup.py install

then i tried to run the example in wiki:
PrimedRPA PrimedRPA_Parameters.txt
i got the following error:

Parameters File Could Not Be Opened
Check File Path.
Please run PrimedRPA --help to see valid options

thank you for your help.

I've come across this error when trying to run the program as well.

Traceback (most recent call last):
File "/home/jmann/anaconda3/lib/python3.7/multiprocessing/pool.py", line 121, in worker
result = (True, func(*args, **kwds))
File "/home/jmann/anaconda3/lib/python3.7/multiprocessing/pool.py", line 47, in starmapstar
return list(itertools.starmap(args[0], args[1]))
File "/home/jmann/anaconda3/bin/PrimedRPA", line 541, in IndentifyingAndFilteringOligos
MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBool = BlastnBackgroundCheck(NucleotideSeq, AllParameter)
File "/home/jmann/anaconda3/bin/PrimedRPA", line 203, in BlastnBackgroundCheck
BackgroundMaxBindingPercentage, BackgroundMaxBindingString, BackgroundHardFail, BackgroundString = SSIdentification(seq, ComplementSeq, False, ShorterBackground)
File "/home/jmann/anaconda3/bin/PrimedRPA", line 324, in SSIdentification
if NucDict[DyanimicSeqList[StringPos]] == FixedSeqList[StringPos]:
IndexError: list index out of range
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
File "/home/jmann/anaconda3/bin/PrimedRPA", line 1034, in
CheckingAlignedOutputFile(AllParameter)
File "/home/jmann/anaconda3/bin/PrimedRPA", line 810, in CheckingAlignedOutputFile
PotentialPrimerProbeOut = pool.starmap(IndentifyingAndFilteringOligos,PrimerProbeCheckParallelInput)
File "/home/jmann/anaconda3/lib/python3.7/multiprocessing/pool.py", line 276, in starmap
return self._map_async(func, iterable, starmapstar, chunksize).get()
File "/home/jmann/anaconda3/lib/python3.7/multiprocessing/pool.py", line 657, in get
raise self._value
IndexError: list index out of range

Hello Everyone,

I'm making a separate ticket for a FileNotFoundError. This was described in issue #1, however not representative of that ticket. Here is some descriptive information about my setup. I am using PrimedRPA to align 2000 sequences with an average length of 12000 bases. These sequences are then being background checked against 5000 sequences with an average length of 12000 bases.

Here is the output that Jeff provided.... I cleared my console so I do not have my copy.

**Traceback (most recent call last):
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 121, in worker
result = (True, func(*args, **kwds))
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 47, in starmapstar
return list(itertools.starmap(args[0], args[1]))
File "/home/jeff/miniconda3/bin/PrimedRPA", line 541, in IndentifyingAndFilteringOligos
MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBool = BlastnBackgroundCheck(NucleotideSeq, AllParameter)
File "/home/jeff/miniconda3/bin/PrimedRPA", line 195, in BlastnBackgroundCheck
fastadict = FastaToDict('Adv_{}_{}.fa'.format(seq,CleanRefID))
File "/home/jeff/miniconda3/bin/PrimedRPA", line 32, in FastaToDict
with open(InputFile) as file_one:
FileNotFoundError: [Errno 2] No such file or directory: 'Adv_GTTGAATATTTACTTTAGATCATAAGCGGGTTGG_AB597287.1.fa'
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
File "/home/jeff/miniconda3/bin/PrimedRPA", line 1034, in
CheckingAlignedOutputFile(AllParameter)
File "/home/jeff/miniconda3/bin/PrimedRPA", line 810, in CheckingAlignedOutputFile
PotentialPrimerProbeOut = pool.starmap(IndentifyingAndFilteringOligos,PrimerProbeCheckParallelInput)
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 276, in starmap
return self._map_async(func, iterable, starmapstar, chunksize).get()
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 657, in get
raise self._value
FileNotFoundError: [Errno 2] No such file or directory: 'Adv_GTTGAATATTTACTTTAGATCATAAGCGGGTTGG_AB597287.1.fa'**

I'm going to dig through the py file and see if I can figure out why this is occurring. I have a hunch that it's looking for .fa but the script is saving the files as blastn_input.fa

Dear Matthew,
The old program which has without the background check was great! Any way how i can get it because i cannot find it anywhere