File path about bioconda-primedrpa HOT 9 OPEN

Hi Jeff,

First could you please double check the PrimedRPA_Parameters.txt file contains all 22, greater than symbols '>' as if there are more or less, this could trigger the error. This could be done with the following command: grep '>' PrimedRPA_Parameters.txt | wc -l

Alternatively, if this doesnt work, could you please try the command-line option by running the following command:

PrimedRPA --RunID Debug --InputFile GCF_000896435.1_ViralProj76727_genomic.fna

from bioconda-primedrpa.

Hi Jeff,

Did this solution work?

Kind regards,
Matt.

from bioconda-primedrpa.

from bioconda-primedrpa.

Hi Matt, yeah, that seems to have worked thanks:
22 '>'s and your files produced three debug_...csv files, with less oligo binding sites than the first.

Now for step 3 and it's produced a folder with blast inputs and outputs, but come up with an error message saying it can't find the
ileNotFoundError: [Errno 2] No such file or directory: 'Adv_TAAGACCGCCTTCGGTCTATAAATTCACAGAG_AF082339.1.fa'

Any suggestions?
Many Thanks, Jeff

from bioconda-primedrpa.

Hi Matt,

Got round to having a go with my own data today. Fine when I'm just producing primers, probes and self-annealing scores, but getting an error when I attempat a cross-reactivity file. Have checked file paths, formatting trimmed sequences to equal length. Seems to be an error with the Blast search of the non-target sequences. Any suggestions please?
Error message when running from scratch i.e. without providing a previously generated alignment File/Binding sites:

Generating Alignment Summary (fine!)
Generating Primer/Probe Binding Site DataFrame
multiprocessing.pool.RemoteTraceback:
"""
Traceback (most recent call last):
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 121, in worker
result = (True, func(*args, **kwds))
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 47, in starmapstar
return list(itertools.starmap(args[0], args[1]))
File "/home/jeff/miniconda3/bin/PrimedRPA", line 541, in IndentifyingAndFilteringOligos
MaxBackgroundScoreBindingScore, MaxScoreBackSeq, HardFailBool = BlastnBackgroundCheck(NucleotideSeq, AllParameter)
File "/home/jeff/miniconda3/bin/PrimedRPA", line 195, in BlastnBackgroundCheck
fastadict = FastaToDict('Adv_{}_{}.fa'.format(seq,CleanRefID))
File "/home/jeff/miniconda3/bin/PrimedRPA", line 32, in FastaToDict
with open(InputFile) as file_one:
FileNotFoundError: [Errno 2] No such file or directory: 'Adv_GTTGAATATTTACTTTAGATCATAAGCGGGTTGG_AB597287.1.fa'
"""

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
File "/home/jeff/miniconda3/bin/PrimedRPA", line 1034, in
CheckingAlignedOutputFile(AllParameter)
File "/home/jeff/miniconda3/bin/PrimedRPA", line 810, in CheckingAlignedOutputFile
PotentialPrimerProbeOut = pool.starmap(IndentifyingAndFilteringOligos,PrimerProbeCheckParallelInput)
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 276, in starmap
return self._map_async(func, iterable, starmapstar, chunksize).get()
File "/home/jeff/miniconda3/lib/python3.7/multiprocessing/pool.py", line 657, in get
raise self._value
FileNotFoundError: [Errno 2] No such file or directory: 'Adv_GTTGAATATTTACTTTAGATCATAAGCGGGTTGG_AB597287.1.fa'

--
Much appreciated, Jeff

from bioconda-primedrpa.

Hi Jeff,

Apologies for the delay in my response and can you please check the version of samtools have installed with bioconda is v1.9 or higher

from bioconda-primedrpa.

Many thanks Matt. Did that via
conda update samtools
and it's upgraded from v1.3.1 to 1.9, but still the same error message.

Let me know if you'd like me to run anything and let you know the error output

Jeff

from bioconda-primedrpa.

Hi Matt,

Have you had a chance to take a look at this please?

Cheers, Jeff

from bioconda-primedrpa.

Had a similar problem installed samtools and updated it and the program works

from bioconda-primedrpa.