Giter Club home page Giter Club logo

insilicopcr's Introduction

README

In-Silico PCR tool

DOI

This script takes a text file with primer sequence (one per line,optinal name in column 2, tab-seperated) and a reference FASTA file as input and identifies primer pairs which amplify a DNA sequence of length less than or equal to a user-specified maximum, at a given Tm and salt concentration. The script outputs the sequences of the primers, the portion of the primer that binds, the number of mismatches, as well as the start and end coordinates of the amplified sequence. It also outputs the Tm of the amplicons and the Tm of amplicon pairs.

Dependencies

These may be installed by running

pip install PCRinSilico

Usage

PCRinSilico [options]
   --primer_seq [path to primer sequence file, one primer per line]
   --ref_fasta_file [path to reference FASTA file]

Options

Argument Description Default
--annealing_temp Annealing temperature (in Celsius). 60.0
--salt_concentration Salt concentration (in nM). 50
--max_amplicon_len Maximum length of PCR products in nucleotides. 2000
--req_five Require the 5' end of the primer to bind? True
--out_file Output file name. "in_silico_PCR"

Example

PCRinSilico \
   --primer_seq ./example/primers.txt \
   --ref_fasta_file  ./example/ref.fasta

in_silico_PCR.tsv

qseq1 qseq2_input qstart1 qend1 direction1 mismatch2 qseq2 qseq1_input qstart2 qend2 direction2 mismatch1 binding_pos_diff reference ref_region
kkd_F_2 gaacaccggcagtggttc 1 18 + 0 sge_R ctgccgcagcggt 1 13 - 0 300 example 772, 1072
kkd_R accgagctgccggacggcac 1 20 + 0 sge_R ctgccgcagcggt 1 13 - 0 318 example 772, 1090

in_silico_PCR_amplicon_interactions.tsv

amplicon1_PF amplicon1_PR amplicon2_PF amplicon2_PR tm
kkd_F_2 sge_R kkd_R sge_R 90.22726832

in_silico_PCR_primer_dimears.tsv

Sequence1 Sequence2 MeltingTemp
sge_F sge_R 75
sge_F kkd_F 72
sge_F kkd_F_2 73
sge_F kkd_R 79
sge_R kkd_F 74
sge_R kkd_F_2 74
sge_R kkd_R 80
kkd_F kkd_F_2 72
kkd_F kkd_R 78
kkd_F_2 kkd_R 78

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.