Giter Club home page Giter Club logo

vtam's Introduction

VTAM - Validation and Taxonomic Assignation of Metabarcoding Data

https://readthedocs.org/projects/vtam/badge/?version=latest

VTAM is a metabarcoding package with various commands to process high throughput sequencing (HTS) data of amplicons of one or several metabarcoding markers in FASTQ format and produce a table of amplicon sequence variants (ASVs) assigned to taxonomic groups. If you use VTAM in scientific works, please cite the following article:

González, A., Dubut, V., Corse, E., Mekdad, R., Dechatre, T. and Meglécz, E.. VTAM: A robust pipeline for processing metabarcoding data using internal controls. bioRxiv: 10.1101/2020.11.06.371187v1.

Commands for a quick installation:

conda create --name vtam python=3.9 -y
conda activate vtam

Then install dependencies

python3 -m pip install cutadapt
conda install -c bioconda blast -y
conda install -c bioconda vsearch -y
python3 -m pip install vtam

Commands for a quick working example:

vtam example
cd example
snakemake --printshellcmds --resources db=1 --snakefile snakefile.yml --cores 4 --configfile asper1/user_input/snakeconfig_mfzr.yml --until asvtable_taxa

The table of amplicon sequence variants (ASV) is here:

(vtam) user@host:~/vtam/example$ head -n4 asper1/run1_mfzr/asvtable_default_taxa.tsv
run marker  variant sequence_length read_count      tpos1_run1      tnegtag_run1    14ben01 14ben02 clusterid       clustersize     chimera_borderlineltg_tax_id    ltg_tax_name    ltg_rank        identity        blast_db        phylum  class   order   family  genus   species sequence
run1        MFZR    25      181     478     478     0       0       0       25      1       False   131567  cellular organisms      no rank 80      coi_blast_db_20200420                                                   ACTATACCTTATCTTCGCAGTATTCTCAGGAATGCTAGGAACTGCTTTTAGTGTTCTTATTCGAATGGAACTAACATCTCCAGGTGTACAATACCTACAGGGAAACCACCAACTTTACAATGTAATCATTACAGCTCACGCATTCCTAATGATCTTTTTCATGGTTATGCCAGGACTTGTT
run1        MFZR    51      181     165     0       0       0       165     51      1       False                                   coi_blast_db_20200420           ACTATATTTAATTTTTGCTGCAATTTCTGGTGTAGCAGGAACTACGCTTTCATTGTTTATTAGAGCTACATTAGCGACACCAAATTCTGGTGTTTTAGATTATAATTACCATTTGTATAATGTTATAGTTACGGGTCATGCTTTTTTGATGATCTTTTTTTTAGTAATGCCTGCTTTATTG
run1        MFZR    88      175     640     640     0       0       0       88      1       False   1592914 Caenis pusilla  species 100     coi_blast_db_20200420   Arthropoda      Insecta Ephemeroptera   Caenidae        Caenis  Caenis pusilla  ACTATATTTTATTTTTGGGGCTTGATCCGGAATGCTGGGCACCTCTCTAAGCCTTCTAATTCGTGCCGAGCTGGGGCACCCGGGTTCTTTAATTGGCGACGATCAAATTTACAATGTAATCGTCACAGCCCATGCTTTTATTATGATTTTTTTCATGGTTATGCCTATTATAATC

The database of intermediate data is here:

 (vtam) user@host:~/vtam/example$ sqlite3 asper1/db.sqlite '.tables'
FilterChimera                    Sample
FilterChimeraBorderline          SampleInformation
FilterCodonStop                  SortedReadFile
FilterIndel                      TaxAssign
FilterLFN                        Variant
FilterLFNreference               VariantReadCount
FilterMinReplicateNumber         wom_Execution
FilterMinReplicateNumber2        wom_FileInputOutputInformation
FilterMinReplicateNumber3        wom_Option
FilterPCRerror                   wom_TableInputOutputInformation
FilterRenkonen                   wom_TableModificationTime
Marker                           wom_ToolWrapper
ReadCountAverageOverReplicates   wom_TypeInputOrOutput
Run

The VTAM documentation is hosted at ReadTheDocs.

VTAM is maintained by Aitor González (aitor dot gonzalez at univ-amu dot fr) and Emese Meglécz (emese dot meglecz at univ-amu dot fr).

vtam's People

Contributors

aitgon avatar mrmekdad avatar raphaelhebert avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.