pmelsted / bfcounter Goto Github PK

Hi!
I am trying to quantify short kmers - so in this case 9mers.
I used the following config:

./BFCounter count temp_${file}.fastq -k 9 -n 300000 -t 10 -o ${file}_bfoutput
There are about 260000 possible 9mers so I set the -n to 300000.

Once I dump the binary output, I get

AAAAAAAAA 1006644076

So somehow it only added the AAAAAAAAA kmer but no others.

Any ideas what I'm doing wrong?

Thanks in advance for your support!

both count and dump create no output with my fasta files
./BFCounter dump -k 5 -i ~/faireparsed/e16-18hr_faire/macs2.fa -o outfile
help ..

head ~/faireparsed/e16-18hr_faire/macs2.fa

2L:287-539
TCTTATATTACCGCAAACCCAAAAAGACAATACACGACAGAGAGAGAGAGCAGCGGAGATATTTAGATTGCCTATTAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGAGAAATATGA
2L:5543-5989
CAAACACAAAATGACAATGCA
....

Is the program easy to modify to show k-mers with a count of 1? This would be a helpful option.

Hi ... I would very much like to test your script ...but I do not seem to get it to work

I have complied it ate testing running with:

BFCounter count --kmer-size=10 --num-kmers=10000 --threads=10 -o output.txt --verbose -c 1 test.fa
Using bloom filter size: 4 bits
Estimated false positive rate: 0.146342
Segmentation fault

Can you help?

Also ... I am not sure what the --num-kmers is exactly can you explain ? Many thanks

Duarte

The url in you paper is unavailable so that I cannot get the example data sets.

Hi

We are working on analysis of Bioinformatics tools (related to Kmer counting) and BFCounter is one of them. We have gone through readme file and it is very helpful. As we are doing analysis so we want to be very sure about details. It would be great if you help us validating below details.

Data structure and Sorting Algo: Bloom Filter, Hash table/ Hashing
Approach: In-Memory
The limit of k-size : Arbitrary large k-mer lengths (any ideal length)
Supports online k-mer frequency retrieval : No
Supports compressed file processing : Yes

Thanks
Tarang

Hi
I have quick query and it is related to support for compressed datatset.
Does BFCounter supports compressed datatset(gzip). I am not sure on #this.