Giter Club home page Giter Club logo

Comments (4)

apetkau avatar apetkau commented on August 11, 2024

Thanks so much for reporting @bgruening . Your assessment makes sense. A better error message would be useful here 😄

I'll see if I can reproduce it.

from staramr.

bgruening avatar bgruening commented on August 11, 2024

Thanks @apetkau!

from staramr.

emarinier avatar emarinier commented on August 11, 2024

I can't seem to recreate this error in the newest version (38f24ad). Let me know if you want to me to try with the same data that gave you the error.

Example with BLAST Results:

rm -rf out-blast out-sum
staramr search --output-hits-dir out-blast --output-summary out-sum staramr/tests/integration/data/16S_gyrA_beta-lactam.fsa

Output Summary (out-sum):

Isolate ID      Quality Module  Genotype        Predicted Phenotype     Plasmid Scheme  Sequence Type   Genome Length   N50 value       Number of Contigs Greater Than Or Equal To 300 bp       Quality Module Feedback
16S_gyrA_beta-lactam    Failed  blaIMP-42       ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftriaxone, meropenem      None    -       -       5220    5220    1       Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

BLAST Output (out-blast/resfinder_16S_gyrA_beta-lactam.fsa):

>blaIMP-42_1_AB753456 isolate: 16S_gyrA_beta-lactam, contig: 16S_rrsD, contig_start: 4381, contig_end: 5121, database_gene_start: 1, database_gene_end: 741, hsp/length: 741/741, pid: 99.73%, plength: 100.00%
ATGAGCAAGTTATCTGCATTCTTTATATTTTTGTTTTGCAGCATTGATACCGCAGCAGAG
TCTTTGCCAGATTTAAAAATTGAAAAGCTTGATGAAGGCGTTTATGTTCATACTTCGTTT
GAAGAAGTTAACAGGTGGGGCGTTGTTCCTAAACATGGTTTGGTGGTTCTTGTAAATGCT
GAGGCTTACCTAATTGACACTCCATTTACGGCTAAAGATACTGAAAAGTTAGTCACTTGG
TTTGTGGAGCGTGGCTATAAAATAAAAGGCAGCATTTCCTCTCATTTTCATAGCGACAGC
ACGGGCGGAATAGAGTGGCTTAATTCTCGATCTATCCCCACGTATGCATCTGAATTAACA
AATGAACTGCTTAAAAAAGACGGTAAGGTTCAAGCCACAAATTCATTTAGCGGAGTTAAC
TATTGGCTAGTTAAAAATAAAATTGAAGTTTTTTATCCAGGCCCGGGACACACTCCAGAT
AACGTAGTGGTTTGGTTGCCTGAAAGGAAAATATTATTCGGTGGTTGTTTTATTAAACCG
TACGGTTTAGGCAATTTGGGTGACGCAAATATAGAAGCTTGGCCAAAGTCCGCCAAATTA
TTAAAGTCCAAATATGGTAAGGCAAAACTGGTTGTTCCAAGTCACAGTGAAGTTGGAGAC
GCATCACTCTTGAAACTTACATTAGAGCAGGCGGTTAAAGGGTTAAACGAAAGTAAAAAA
CCATCAAAACCAAGCAACTAA

Example with NO BLAST Results:

too-short.fsa:

>SHORT
A
rm -rf out-blast out-sum
staramr search --output-hits-dir out-blast --output-summary out-sum too-short.fsa

Output Summary (out-sum):

Isolate ID      Quality Module  Genotype        Predicted Phenotype     Plasmid Scheme  Sequence Type   Genome Length   N50 value       Number of Contigs Greater Than Or Equal To 300 bp       Quality Module Feedback
too-short       Failed  None    Sensitive       None    -       -       1       1       0       Genome length is not within the acceptable length range [4000000,6000000] ; N50 value is not greater than the specified minimum value [10000]

BLAST Output (out-blast/):

ls -l out-blast/
total 0

And there was no error message.

from staramr.

apetkau avatar apetkau commented on August 11, 2024

Fixed in #160

from staramr.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.