Giter Club home page Giter Club logo

rg4detector's Introduction

rG4detector

We present rG4detector, a convolutional neural network for predicting rG4 folding of any given sequence based on rG4-seq data. rG4-seq experimental protocol was employed to generate transcriptome-wide rG4 maps of human HeLa cells (accession code GSE77282). In this study, we used the experimental raw data to extract RSR (ratio of stalled reads) scores across the transcriptome, and used this information to train rG4detector. rG4detector assigns an rG4 propensity score for any RNA sequence. in addition, we utilized rG4detector predictions to detect rG4 forming sequences in a given transcript/any long RNA sequence.

Get rG4detector predictions

rG4detector can operate in two different modes:

  1. prediction - for a given fasta file, rG4detector will predict the propensity of each sequence to form an rG4 structure.
  2. detection - for a given fasta file, rG4detector will assign a score to each sequence nucleotide, which indicates the probability of this nucleotide to belong to an rG4 folding sequence.

Prediction mode

In order to predict the propensity of each sequence in a fasta file to form an rG4 structure, run:

python code/predict_fasta.py -f <fasta_file> -o <output_directory>

If the rG4detector models aren't under models/, pass the model directory using -m flag. The program will output the results to the output directory under rG4detector_prediction.csv.

Detection mode

In order to utilize rG4detector predictions in a detection task use the -d/--detect flags, as follow:

python code/predict_fasta.py -d -f <fasta_file> -o <output_directory>

The program will output the results to the output directory under rG4detector_detection.csv. For plotting each sequence scores, use the -p/--plot flags (recommended for fasta files with limited number of sequences).

Reproduce rG4detector model

Prerequisites

The model is implemented with Keras python library with Tensorflow backend (version 2.5.0).

Model training

python code/train_rG4detector.py 

The model will be saved under model/ .

rg4detector's People

Contributors

maorturnbgu avatar maorturn avatar orensteinlab avatar

Stargazers

Pim Van den Bosch avatar Donn Liew avatar  avatar  avatar

Watchers

 avatar

rg4detector's Issues

Can't run prediction, error in one_hot_enc function

Hi, I'm trying to run rG4detector to get the rG4 propensity per sequence but encountered an error.

Background
Here are the steps I did:

  1. I created a fasta file with the following sequences as the first two in the file as examples:
>0
GCAGCTGGTCACCAGTCTCTGAGGGCACCTCATGGACCAGGGGCTGGTGGCCCAGGCCAGGGAGGGAACCCTGGGCAGGGCTCTGGTGGGAGAGGGAGACAGATGGAGGCAGTGGCTGGTGGGCCACTCTCTCCAGGTG
>1
GGCGGAGGGCAAGTAGCAAGGGGGCGGGGTGTGGCCGCCGGAAGCCTAGCCGCTGCTCGGGGGGGACCTGCGGGCTCAGGCCCGGG
  1. I then ran using the following command following the readme instructions:
python code/predict_fasta.py -f input.fa -o out

Issue
However, I get the following error message:
Screen Shot 2022-12-12 at 6 15 13 PM

Execution time

Hi,
I want to run rG4detector on my RNA-seq samples.
Each FASTA file contains between 70M-100M sequences.
When running the tool on a test FASTA file, with only 5 sequences, it took ~0.8 sec for each sequence.
I'm afraid the total runtime on the real samples would be enormous.
Is there a way to make the tool run in parallel or define a number of threads to run on?
How would you recommend me to use it so the runtime would be reasonable?
Thank you,
Efi

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.