millanp95 / delucs Goto Github PK

Dear authors,

Your work is very valuable. I am a doctor worked in a hospital, not very familiar to the code.
Here is a question, how to know which specific sequence contributed to the classification?

Thanks very much.

Hi,
Thanks for developing this tool!
While running EvaluateDeLUCS.py on test files (test 1) I got following error message:

Traceback (most recent call last):
File "EvaluateDeLUCS.py", line 3, in
import torch
File "/src/python3/envs/delucs/lib/python3.7/site-packages/torch/init.py", line 84, in
from torch._C import *
ImportError: /src/python3/envs/delucs/lib/python3.7/site-packages/torch/lib/libmkldnn.so.0: undefined symbol: cblas_sgemm_alloc

I tried to install mkl with intel (through conda install) and I am still getting the same error message.

Thanks,
Best regards,
Gautam

In the paper you specify explicitly the clusterning of DNA sequences. Can DeLUCS be used for clustering of non-DNA sequences, for example sequences of RNA viruses, or only specific genes?

TrainDeLUCS.py line 116
SingleRun.py line 114
parser.add_argument('--n_custers', action='store', type=int, default=0)
typo: n_custers => n_clusters

Hi.

I'm excited to try this tool out. Just wondering how it handles N's?

Liam

HI,

I'm trying to test your tool on some COVID seqs downloaded from gisaid. I put 500 seqs in fasta format in a folder called 'fas', I got the error 'File name too long' so I just named them 1-500, but this error persists.

Just to be clear; I have a folder called fas. In it are 500 fastas, called 1.fa, 2,fa etc.

They are formatted as such:

head fas/1.fa

>1.B_1
ACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCAC
TCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACA

I ran them as below (on ubuntu with Python 3.8.5) and got the below error:

build_dp.py --data_path = fas 
/home/binfie1/binfiebin/DeLUCS/src/build_dp.py: line 12: 
This script builds a dataset in pickle
format from a folder with FASTA files. The
desired label of the file must be in the file ID
after the accession number separated by a dot.

:param dataset: Name of the Dataset.
:param data_path: Path of the folder with the sequences.
:returns: None

Example: python build_dp.py --data_path = '../data/Influenza'
: File name too long
/home/binfie1/binfiebin/DeLUCS/src/build_dp.py: line 14: import: command not found
from: can't read /var/mail/Bio
/home/binfie1/binfiebin/DeLUCS/src/build_dp.py: line 16: import: command not found
/home/binfie1/binfiebin/DeLUCS/src/build_dp.py: line 17: import: command not found
/home/binfie1/binfiebin/DeLUCS/src/build_dp.py: line 20: syntax error near unexpected token `('
/home/binfie1/binfiebin/DeLUCS/src/build_dp.py: line 20: `def replace(seq):'

It seems as though there are multiple import errors.

Any help would be appreciated,
Liam

HI,

getting is error:

python TrainDeLUCS.py --data_dir=/home/binfie1/liam_dev/delucs/pairs --out_dir=/home/binfie1/liam_dev/delucs/train1
Traceback (most recent call last):
  File "TrainDeLUCS.py", line 193, in <module>
    main()
  File "TrainDeLUCS.py", line 127, in main
    x_train, x_test, y_test = pickle.load(open(filename, 'rb'))
NotADirectoryError: [Errno 20] Not a directory: '/home/binfie1/liam_dev/delucs/pairs/testing_data.p'

Seems to come from trying to open the output from get_pairs.py, which ran as.

python get_pairs.py --data_path=/home/binfie1/liam_dev/delucs/train --k=6 --modify='mutation' --output=/home/binfie1/liam_dev/delucs/pairs
............computing learning pairs................
......saving mutated pairs.....