This repository contains the submission of Marcus Motill for programming project 2 in Bioinformatics.

Marcus reached out to the instructor of the course with questions surrounding the EM algorithm but did not get a response. Therefore, the best interpretation of the course material was implemented in this project.

• User can enter as many sequences as they want in FASTA format.
  • For example see sample input for more sequences:

    >Sequence 1
    TCAGAACCAGTTATAAATTTATCATTTCCTTCTCCACTCCT
    >Sequence 2
    CCCACGCAGCCGCCCTCCTCCCCGGTCACTGACTGGTCCTG
    >Sequence 3
    TCGACCCTCTGGAACCTATCAGGGACCACAGTCAGCCAGGCAAG
    >Sequence 4
    AAAACACTTGAGGGAGCAGATAACTGGGCCAACCATGACTC
    >Sequence 5
    GGGTGAATGGTACTGCTGATTACAACCTCTGGTGCTGC
    >Sequence 6
    AGCCTAGAGTGATGACTCCTATCTGGGTCCCCAGCAGGA
  

- Users can specify the motif length to be found by modifying the text box in the GUI
- Program will return the best motif and log odds score for each sequence along with the best motif and log odds score for the whole alignment
- If the motif length is longer than a sequence or the entire input an error dialog will alert the user

## Example

Using sample input above and a motif length of 5 the results are:

Best Motif for Sequence 1 with log odds score of -3.754888: TCCAC Best Motif for Sequence 2 with log odds score of -4.339850: CCCAC Best Motif for Sequence 3 with log odds score of -3.754888: TCGAC Best Motif for Sequence 4 with log odds score of -4.339850: CCAAC Best Motif for Sequence 5 with log odds score of -3.754888: ACAAC Best Motif for Sequence 6 with log odds score of -4.754888: TCCCC Best Motif for alignment with log odds score of -3.754888: TCCAC

### GUI output
![GUI](screenshots/results1.png)

## Platform and Language
Project was built on [intelliJ community edition](https://www.jetbrains.com/idea/download/) in Java