Comments (3)
From [email protected] on June 17, 2012 10:21:01
Could you make a (small) FASTQ file available to me that causes this, so I can reliable reproduce the problem?
from cutadapt.
From trgibbons on June 17, 2012 12:28:29
Marcel,
I've contacted our collaborators for permission to share larger files. For
now, I did a manual binary search to track down a specific sequence from
one of the files that is able to reproduce the error:
@HWI-ST797:140:C0A89ACXX:3:1101:6462:1900 2:N:0:TAGCTT
GTCACATTCTTAAGCGCCCCGAGGGTGTACCCTTTTCCGCCGGCGTGGGGGAAGACCAGGCCTTGGGAAAGAAAATCGAGAACTCCCTGACGCCTAGTTAG
+
@@@DFFFDBHFF#########################################################################################
The long string of # jumped out at me, so I searched through some other
files that had broken cutadapt, and discovered an apparent pattern. It
seems that low-quality reads with quality scores comprised mostly though
not completely of # break cutadapt. I've attached a few more examples.
The sequences in 1_1-break_cutadapt.fastq and L1P_2-break_cutadapt.fastq
have quality scores comprised completely of #, and so do not break cutadapt.
Good luck,
Ted
from cutadapt.
From [email protected] on June 18, 2012 02:07:08
Thank you, I could reproduce the problem here, so you don’t need to share the large files. I’ve fixed the problem now. It was caused by some indexing problems that were apparent only on very short reads and therefore occurred only when the reads were quality trimmed.
I’m going to release cutadapt 1.1 shortly, which will contain the fix. In the meantime, you can get the source code instead.
Status: Fixed
from cutadapt.
Related Issues (20)
- Remove the "Incomplete adapter sequence" warning
- Nanopore adapter detection HOT 1
- "OverflowError: FASTA/FASTQ record does not fit into buffer" when trimming ONT reads HOT 7
- Unexpected trimming behavior HOT 5
- cutadapt: error: cutadapt not able to trim the desired adapto HOT 3
- Error in FASTQ file at line 20136: Length of sequence and qualities differ HOT 2
- Adapter matches in the middle of a read masked with N HOT 2
- Feature request: shorten paired-end reads with separate values for --length HOT 1
- Help to get accurate counts of demultiplexed amplicons using cutadapt HOT 2
- Adapters in form of file and linked mode HOT 4
- Problems reading stdin on Windows 11 Python 3.12 HOT 5
- Heterogeneity Spacers and Primers HOT 2
- Using --revcomb on paired-end data HOT 1
- Issue importing fasta files to Cutadapt virtual environment HOT 1
- -m don't correctly work for pair-end analysis HOT 1
- Primer sequence trimming. Cutadapt does not cut all of them HOT 1
- Should I use -a or -g when demultiplexing ONT reads with dual barcodes? HOT 3
- Unable to trim primers from my interleaved fastq files HOT 4
- cutadapt not recognizing second input file HOT 1
- Update bioconda-recipe to support osx-arm64 HOT 2
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from cutadapt.