--wildcard-file throws IndexError: string index out of range about cutadapt HOT 3 CLOSED

From [email protected] on June 17, 2012 10:21:01

Could you make a (small) FASTQ file available to me that causes this, so I can reliable reproduce the problem?

from cutadapt.

From trgibbons on June 17, 2012 12:28:29

Marcel,

I've contacted our collaborators for permission to share larger files. For
now, I did a manual binary search to track down a specific sequence from
one of the files that is able to reproduce the error:

@HWI-ST797:140:C0A89ACXX:3:1101:6462:1900 2:N:0:TAGCTT
GTCACATTCTTAAGCGCCCCGAGGGTGTACCCTTTTCCGCCGGCGTGGGGGAAGACCAGGCCTTGGGAAAGAAAATCGAGAACTCCCTGACGCCTAGTTAG
+
@@@DFFFDBHFF#########################################################################################

The long string of # jumped out at me, so I searched through some other
files that had broken cutadapt, and discovered an apparent pattern. It
seems that low-quality reads with quality scores comprised mostly though
not completely of # break cutadapt. I've attached a few more examples.
The sequences in 1_1-break_cutadapt.fastq and L1P_2-break_cutadapt.fastq
have quality scores comprised completely of #, and so do not break cutadapt.

Good luck,
Ted

from cutadapt.

From [email protected] on June 18, 2012 02:07:08

Thank you, I could reproduce the problem here, so you don’t need to share the large files. I’ve fixed the problem now. It was caused by some indexing problems that were apparent only on very short reads and therefore occurred only when the reads were quality trimmed.

I’m going to release cutadapt 1.1 shortly, which will contain the fix. In the meantime, you can get the source code instead.

Status: Fixed

from cutadapt.