Comments (2)
From [email protected] on March 09, 2012 02:12:26
Sorry for the late reply. I have had little time to work on cutadapt. What you desire actually works by using a feature of the Bashs shell. Write a “configuration file” adapters.conf that contains the necessary command-line parameters, for example:
-a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
-a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
and so on. The file can contain line breaks. They will be replaced by spaces.
Then run cutadapt as follows:
cutadapt -m 20 $(<adapters.conf) input.fastq > output.fastq
If you don’t use Bash, then writing $(cat adapters.conf) may work.
I know this is not quite what one wants as a proper configuration file would support comments and proper syntax checking. I hope it will do for now. Sorry again this has taken so long. I will leave this report open for now.
Status: Accepted
Labels: -Type-Defect -Priority-Medium Type-Enhancement Priority-Low
from cutadapt.
From [email protected] on August 05, 2014 04:36:24
This has now been implemented and is part of cutadapt 1.5.
Status: Fixed
from cutadapt.
Related Issues (20)
- Remove the "Incomplete adapter sequence" warning
- Nanopore adapter detection HOT 1
- "OverflowError: FASTA/FASTQ record does not fit into buffer" when trimming ONT reads HOT 7
- Unexpected trimming behavior HOT 5
- cutadapt: error: cutadapt not able to trim the desired adapto HOT 3
- Error in FASTQ file at line 20136: Length of sequence and qualities differ HOT 2
- Adapter matches in the middle of a read masked with N HOT 2
- Feature request: shorten paired-end reads with separate values for --length HOT 1
- Help to get accurate counts of demultiplexed amplicons using cutadapt HOT 2
- Adapters in form of file and linked mode HOT 4
- Problems reading stdin on Windows 11 Python 3.12 HOT 5
- Heterogeneity Spacers and Primers HOT 2
- Using --revcomb on paired-end data HOT 1
- Issue importing fasta files to Cutadapt virtual environment HOT 1
- -m don't correctly work for pair-end analysis HOT 1
- Primer sequence trimming. Cutadapt does not cut all of them HOT 1
- Should I use -a or -g when demultiplexing ONT reads with dual barcodes? HOT 3
- Unable to trim primers from my interleaved fastq files HOT 4
- cutadapt not recognizing second input file HOT 1
- Update bioconda-recipe to support osx-arm64 HOT 2
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from cutadapt.