Comments (4)
From [email protected] on October 26, 2011 02:00:43
Hi, thanks for your suggestion. I think it's a great idea. But just to clarify: Is this about two distinct suggestions? One being BAM input and output, the other being reading any file format from standard input and writing to standard output? The latter is already possible, just use dash "-" as the input file name. I've added a sentence to the command-line help to make this clearer.
Labels: -Type-Defect Type-Enhancement
from cutadapt.
From [email protected] on May 08, 2012 14:23:40
The original request also mentioned:
"Also I would add the option to provide a txt file with the adaptors and their names to add them to the reports."
I currently use an conf file as you mentioned in the documentation to give cutadapt a long list of adapters. However, it would be nice, as the mentioned, to be able to "name" those adapters.
something like:
-a GATCGGAAGAGCACACGTCTGA "Tru-seq Adapter 1"
from cutadapt.
From [email protected] on October 08, 2014 13:08:30
Hi Carlos, since you just filed issue #82 , maybe you could also comment on your report regarding BAM input/output. I'm wondering if I should just close this. I like the idea of storing reads in BAM files instead of FASTQ files, but I don't know if people are actually doing it.
from cutadapt.
From [email protected] on October 16, 2014 13:26:45
Status: WontFix
from cutadapt.
Related Issues (20)
- FYI: Macos-14 runners available for M1 macs. HOT 2
- Reads not trimmed for PE with poly-G HOT 5
- Cutadapt 4.7 hangs when using process substitution HOT 10
- Crash on sending interleaved output to stdout
- cutadapt cannot read from stdin with xopen 2.0.0 HOT 3
- Feature request: Support for multiple FastQ pairs
- Ensuring to find the correct file after Demultiplexing my 16S amplicon raw dataset with combinatorial dual indexes cutadapt command HOT 5
- Pipe multiple adatper trimming steps is unsupported when using the python API. HOT 5
- Error: BiocParallel errors HOT 5
- Remove the "Incomplete adapter sequence" warning
- Nanopore adapter detection HOT 1
- "OverflowError: FASTA/FASTQ record does not fit into buffer" when trimming ONT reads HOT 7
- Unexpected trimming behavior HOT 5
- cutadapt: error: cutadapt not able to trim the desired adapto HOT 3
- Error in FASTQ file at line 20136: Length of sequence and qualities differ HOT 2
- Adapter matches in the middle of a read masked with N HOT 2
- Feature request: shorten paired-end reads with separate values for --length HOT 1
- Help to get accurate counts of demultiplexed amplicons using cutadapt HOT 2
- Adapters in form of file and linked mode HOT 4
- Problems reading stdin on Windows 11 Python 3.12 HOT 5
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from cutadapt.