Giter Club home page Giter Club logo

sramap's Introduction

SRAMAP

Convert SRA data to mapped BAM/SAM/Bigwig/Bed by one step in parallel computation

$ git clone https://github.com/maofengbiao/SRAMAP.git

$ chmod 750 bam2bedgraph

$ chmod 750 SRAMAP

#:::Install Dependencies:::

#1. please install trim_galore and bowtie2 !!!!!!!

$ wget https://repo.continuum.io/miniconda/Miniconda2-latest-Linux-x86_64.sh

$ bash Miniconda3-latest-Linux-x86_64.sh

$ conda install -c bioconda trim-galore=0.4.1

$ conda install bowtie2

#2. please install bedtools, samtools and deeptools !!!!!!!!

$ conda install -c bioconda bedtools=2.26.0

$ conda install -c bioconda samtools=1.3.1

$ conda install -c bioconda deeptools=2.4.2

#3. please install GNU Parallel and fastq-dump (in sratoolkit) !!!!!!!

$ conda install -c bioconda parallel=20160622

$ wget http://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/current/sratoolkit.current-centos_linux64.tar.gz

$ tar zxvf sratoolkit.current-centos_linux64.tar.gz

#4. basic shell knowlege !!!!!!!

$ export PATH=$PATH:/path/to/sratoolkit.x.x.x-centos_linux64/bin:/path/to/SRAMAP

#:::SRAMAP Usage:::

$ ./SRAMAP -h

-i input SRR list file

-o output directory

-w web site of SRR

-g genome reference indexed by bowtie2

-a adapter 1 [GATCGGAAGAGCACACGTCT]

-b adapter 2 [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT]

-q quality of trimming [20]

-p phred system value [33]

-t process number [10]

-m mapQ required [30]

-s size of bin for generating wig [50]

-e extend bases for reads for bam2bigwig [200]

-h the helpinformation #:::SRAMAP Example::: $ /path/to/SRAMAP \

-i /path/to/srr.list \

-o /path/to/Wdr5_GSE22934 \

-w ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra-instant/reads/ByStudy/sra/SRP/SRP002/SRP002862 \

-g /path/to/db/mm10/Sequence/Bowtie2Index/genome \

-a GATCGGAAGAGCACACGTCT \

-b AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \

-q 20 \

-p 33 \

-t 10 \

-m 30 \

-s 50 \

-e 200

$ cat /path/to/srr.list

SRR060173

SRR060174

SRR060175

sramap's People

Contributors

maofengbiao avatar

Watchers

 avatar  avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.