Giter Club home page Giter Club logo

gene-matcher's Introduction

gene-matcher

Algorithm for determining similar regions between nucleic acid sequences.

require 'gene-matcher'

# Obtain regions from 2 sequences.
sw = SmithWaterman.instance
a = sw.alignment("AGTCAGTC","CAGC")
a.alignmentI # => "CAGTC"
a.alignmentJ # => "CAG-C"
a.alignment  # => ":::.:"

# Store alignments which satisfy the score condition.
m = Matcher.new("GGAATGGGACAGCAGAGGGGGCTGTGTTTCATCTCAGCGATCAACTGGTTGACCTAT",0.1)
m.scan("TGGGGTTCCAAGCTTGGTTTTCCAAATCCTGTCTCTCCAGCTCCTGCTCCNCTTAAGACCATTTGCTGTGTCAACCGGTCTGAACTAGAGGAATCTGAGGTCAGCAGAGGTCACCCAGACTCAGGGTTCAAACAGCTAATGAGGAGACAAGGAGGTCAGCCTCCTGCTGTCTGTGGCCTACATGGGAGCAGCGGCGATCTGGGAACAACACTGCGGTTTGAG")
m.alignments # => #<Alignment:0x0000000108b02ff8>
#   @alignmentI="ACTCAGGGTTCAAACAGCTAAT-GAGGAGACTAAGGAGGTCAGCCTCCTGCTGTCTGTGGCCTACA",
#   @alignmentJ="A-T-AGG--TCAACCAGTTGATCGCTGAGATGAAACA---CAGCCCCCT-CTG-CTGTCCCATTCC",
#   @score=25.46969696969697,

See test/test-matcher.rb for more exsamples.

Histories

  • 23.08.02 Released the first version.
  • 23.09.11 Stop having scores as property, they are converted into methods.

Contributors

gene-matcher's People

Contributors

lm-itou avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.