lanl / adscodex Goto Github PK
View Code? Open in Web Editor NEWADS Codex is a codec for organic molecular archives.
License: Other
ADS Codex is a codec for organic molecular archives.
License: Other
Hi,
I'm running the encoder tool (using macOS):
adscodex % go run encode/main.go -dseqnum 3 -rseqnum 2 -etbl ~/ALTGOPATH/src/adscodex/tbl/h4g2-17-13.etbl \ -p3 CAGTGAGCTGGCAACTTCCA -p5 CGACATCTCGATGGCAGCAT $HOME/32kfilerand >> dna.out
flag provided but not defined: -etbl
Usage of /var/folders/lt/0b3s6w253tg4jq9x3qh9qk740000gn/T/go-build1056971182/b001/exe/main:
-addr uint
start address
-compat
compatibility with 0.9
-dbnum int
number of data blocks (default 5)
-dseqnum int
number of data oligos per erasure group (default 3)
-dtcsum string
L1 data blocks checksum type (parity or even) (default "parity")
-mdcnum int
metadata error detection blocks (default 2)
-mdcsum string
L1 metadata blocks checksum type (rs for Reed-Solomon, crc for CRC) (default "crc")
-mdsz int
metadata block size (default 4)
-p3 string
3'-end primer (default "CAGTGAGCTGGCAACTTCCA")
-p5 string
5'-end primer (default "CGACATCTCGATGGCAGCAT")
-rndmz
randomze data
-rseqnum int
number of erasure oligos per erasure group (default 2)
-shuffle int
random seed for shuffling the order of the oligos (0 disable)
exit status 2
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.