Giter Club home page Giter Club logo

adscodex's People

Contributors

dmanno avatar lionkov avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

adscodex's Issues

flag provided but not defined: -etbl

Hi,

I'm running the encoder tool (using macOS):

adscodex % go run encode/main.go -dseqnum 3 -rseqnum 2 -etbl ~/ALTGOPATH/src/adscodex/tbl/h4g2-17-13.etbl \ -p3 CAGTGAGCTGGCAACTTCCA -p5 CGACATCTCGATGGCAGCAT $HOME/32kfilerand >> dna.out

flag provided but not defined: -etbl
Usage of /var/folders/lt/0b3s6w253tg4jq9x3qh9qk740000gn/T/go-build1056971182/b001/exe/main:
-addr uint
start address
-compat
compatibility with 0.9
-dbnum int
number of data blocks (default 5)
-dseqnum int
number of data oligos per erasure group (default 3)
-dtcsum string
L1 data blocks checksum type (parity or even) (default "parity")
-mdcnum int
metadata error detection blocks (default 2)
-mdcsum string
L1 metadata blocks checksum type (rs for Reed-Solomon, crc for CRC) (default "crc")
-mdsz int
metadata block size (default 4)
-p3 string
3'-end primer (default "CAGTGAGCTGGCAACTTCCA")
-p5 string
5'-end primer (default "CGACATCTCGATGGCAGCAT")
-rndmz
randomze data
-rseqnum int
number of erasure oligos per erasure group (default 2)
-shuffle int
random seed for shuffling the order of the oligos (0 disable)
exit status 2

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.