hosnajabbari / dinoknot Goto Github PK
View Code? Open in Web Editor NEWRNA/DNA/PMO Pseudoknotted Secondary Structure Interaction Prediction Using Relaxed Hierarchical Folding
dinoknot's People
Contributors
Stargazers
Watchers
dinoknot's Issues
combining sequence and structures with linker order problem
in HFold_interacting.cpp
right now we combine seq1XXXXXseq2 and struct1.....struct2 no matter which sequence/structure is shorter.
But when we setting up the model, we push the shorter sequence's model into the model vector first.
Are we suppose to combine seq1XXXXXseq2 and struct1.....struct2 depending which sequence/structure is shorter as well?
confirm method3 simfold structure
./HFold_interacting_multimodel --so "TGGAGCAATTGATAAATATTTGTAGGGTGGTTGGCTAAAATAATTATAATTCCTTTAAAAGAAATTCTACCCACTAAAGTTAATTTAGAAGTAAAATATAATAGAAATCCAATAATATATTCACCAAATGGATTAAGATGTTCATGAATTATCTTCAAAGTGTTAATCGAATAAGTAATGTGTATGCTTTTCTGTTAAAGAGGAAGTTAGAAGATCTGAGCTCTGAGTGGAAGGCGGTAAACCGTTTACTTCAAGAGCTGAGGGCAAAGCAGCCTGACCTAGCTCCTGGACTGACCACTATTGGAGCCTGTAAGTATACTGGATCCCATTCTCTTTGGCTCTAGCTATTTGTTCAAAAGTGCAACTATGAAGTGATGACTGGGTGAGAGAGAAAATTTGTTTCAATTCTAAAGATAGAGATAAACCTTTGTGTTATTGACTGTGCAAAAAGTCTTAGAGTACATTCCTTGGAAATTGACTCTGATTCAAAGTGTTGCATGACAACGGGA" --or "_________________________________________________________________________________________________________________________________________________________________________________________________(((((((((((____________________________________________________________________________________________________________________________)))))))))))__________________________________________________________________________________________________________________________________________________________________________" --st "CAGGAGCTAGGTCAGGCTGCTTTGC" --tr "_________(((___)))_______" --t1 RNA --t2 PMO
_________________________________________________________________________________________________________________________________________________________________________________________________(((((((((((____________________________________________________________________________________________________________________________)))))))))))__________________________________________________________________________________________________________________________________________________________________________....._________(((___)))_______
((((((((((.....((((((...((((((...................(((........)))...)))))).(((((.....))))).....))))))........(((((........(((((..((((((......))))))..((((.(((((.(((.......(((((((((........(((.....(((((((((((........(((((..(((((((((((.((((((....))))))..((((.(((((..((((......)))).....))))).))))....)))))..))))))..(((....))).)))))...)))))))))))...)))))))))))).........))).))))))))).....))))).........((((((((...((....))..))))))))....((((((...((((........))))....))))))....)))))))))).)))))...((((((...............................(((...))))))))).
don't know if correct (neighbour)
all the if sequence[i] == X and neighbour cases
don't know if this is correct (for loop)
for loop for energy model
test cases that have error
(fixed) ./HFold_interacting_multimodel --so "UUGUGAUGUUGUGUUGUUGUGUUUGCAAUUGGUCUG" --or "_______((((((__________))))))_______" --st "GGAUGUGCGACAACACAAUGAAAGGAUCGAAAAAUG" --tr "___((((______))))___________________" --t1 RNA --t2 RNA
./HFold_interacting_multimodel --so "CCACUGCUUUUCUUUGAUGUCCCCAUUUUGUGGAGCCCAUCAACCCCGCCAUUUCGG" --or "_____________________________________________(((______)))" --st "GCAGUGGCAUAAAAAAGCAAAUAAAGGCAUAUAACAGAGGGUUAAUAACA" --tr "__________________________________________________" --t1 RNA --t2 RNA
HFold_interacting_multimodel --so "GAGUAGUUCAGUGGUAGAACACCACCUUGCCAAGGUGGGGGUCGCGGGUUCGAAUCCCGUCUCGGGCGAAAGCCC" --or "_____________________________________(((((___________)))))_________________" --st "GGGUGCGAUGAGAAGAAGAGUAUUAAGGAUUUACUAUGAUUAGCGACUCUAGGAUAGUGAAAGCUAGAGGAUAGUAACCUUAAGAAGGCACUUCGAGCACCC" --tr "((((________________________________________________________________________))))______________________" --t1 RNA --t2 RNA
what does it mean by G1 is empty structure
h_common.cpp: int is_empty_structure(char* structure)
current implementation: check if output_structure has [
what if one of simfold/hfold/hfold_pkonly failed
should we check if each program call result match the corresponding input structure restrictions?
method2 G1-G problem
when we do G'=G1-G, it removes the restrictions from G and call method1(S,G').
After method1, when it checks the result, it says restriction not matched
current broken case:
./HFold_interacting_multimodel --so "GCAACGAUGACAUACAUCGCUAGUCGACGC" --or "(____________________________)" --st "GCAACGAUGACAUACAUCGCUAGUCGACGCGCAACGAUGACAUACAUCGCUAGUCGACGC" --tr "(__________________________________________________________)" --t1 RNA --t2 RNA
don't know if correct (hairpin size)
size in hairpin
./simfold/src/common/common.cpp : emodel_energy_function and get_pmo_usage_percentages
in emodel_energy_function, it calls get_pmo_usage_percentages.
get_pmo_usage_percentages have this if
if ((i < linker_pos) && (j < linker_pos)) { //if ij on left side of linker
if (strcmp(structure_one_type, OLIGO) == 0) {
*energy_model_one_percentage = 0.5;
*energy_model_two_percentage = 0.5;
} else {
*energy_model_one_percentage = 0.0;
*energy_model_two_percentage = 1.0;
}
} else if ((i > linker_pos+linker_length-1) && (j > linker_pos+linker_length-1)) { //if ij on right side of linker
if (strcmp(structure_two_type, OLIGO) == 0) {
*energy_model_one_percentage = 0.5;
*energy_model_two_percentage = 0.5;
} else {
*energy_model_one_percentage = 0.0;
*energy_model_two_percentage = 1.0;
}
}
what does strcmp(structure_one_type, OLIGO) mean?
why is *energy_model_one_percentage = 0.0; , *energy_model_two_percentage = 1.0; no matter if we are on the left or right side of the linker. Shouldn't it be 1.0 and 0.0 or 0.0 and 1.0 depending which side of the linker we are on?
Also why in the following case, it is 0.25 and 0.75 instead of 0.5 0.5
else if ((i < linker_pos) && (j > linker_pos+linker_length-1)) { //if ij cross the linker
//????????????????????? why not 0.5 0.5
*energy_model_one_percentage = 0.25;
*energy_model_two_percentage = 0.75;
}
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.