jbrowse-adam's People
jbrowse-adam's Issues
add jbrowse as git submodule
Support for alignment records
Here is what JBrowse usually expects for files like BAM/SAM:
{
"features":[
{
"name":"20FUKAAXX100202:1:23:4017:77368",
"seq":"CAGCAGACAATAACAAGAGAATTATTAAGACTTAGAAAAAGACAATTCTTAATACAGAATTTCAAGGGGTGGATTGAGCAAGACTGGAGGCAAAACATCTT",
"cigar":"101M",
"flag":177,
"insert_size":5317675,
"map_qual":60,
"ref_index":0,
"mate_ref":"20",
"mate_ref_index":0,
"mate_start":15363274,
"start":10045599,
"end":10045700,
"xs":0,
"as":96,
"rg":"group1",
"nm":1,
"qual":"38 39 37 38 39 38 38 38 38 38 37 38 38 38 38 39 38 39 38 38 38 39 38 38 40 38 38 39 38 37 38 39 36 37 31 35 38 38 38 39 38 38 38 38 38 39 38 38 39 38 38 38 38 37 38 39 37 38 38 39 39 38 38 38 37 35 37 37 36 38 37 37 38 39 38 37 39 37 38 37 39 37 37 38 38 37 37 39 37 37 37 37 37 37 37 37 37 37 36 37 35",
"strand":-1,
"seq_id":"20",
"uniqueID":"20FUKAAXX100202:1:23:4017:77368_10045599"
}
]
}
We need to produce the same based on ADAM format
Support for VCF files
{
"features":[
{
"start":13806041,
"end":13806042,
"seq_id":"20",
"type":"SNV",
"score":-10.0,
"filter":{
"values":[
"PASS"
],
"meta":{
"description":"List of filters that this site has not passed, or PASS if it has passed all filters"
}
},
"alternative_alleles":{
"values":[
"A"
],
"meta":{
"description":"VCF ALT field, list of alternate non-reference alleles called on at least one of the samples"
}
},
"reference_allele":"G",
"KGPROD":true,
"RSPOS":"13806042",
"SAO":"0",
"VC":"SNV",
"VP":"050000000005000014000100",
"WGT":"1",
"dbSNPBuildID":"134",
"ASP":true,
"KGPhase1":true,
"SSR":"0",
"GMAF":"0.0023",
"description":"SNV G -> A",
"genotypes":{
},
"uniqueID":"SNV_13806041_13806042"
}
]
}
Add support for reference sequences
The following things need to be done:
- Convert FastA to ADAM.
- add support for requests like http://localhost:8080/data/features/ctgA?0=%5Bobject%20Object%5D&reference_sequences_only=true&seqChunkSize=20000&start=760747&end=760776
Document transformation from bam/sam to adam
Document transformation from fastq to adam
Run jbrowse-adam on Amazon AWS
- Store ref genome and aligned reads in s3
- Run Spark cluster as described here: http://spark.apache.org/docs/latest/ec2-scripts.html
- deploy our software on ec2 instance and test results
For AWS access please refer to me
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. ๐๐๐
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google โค๏ธ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.