Giter Club home page Giter Club logo

bold's Introduction

bold

Project Status: Active – The project has reached a stable, usable state and is being actively developed. cran version cran checks R-check codecov.io rstudio mirror downloads

bold accesses BOLD barcode data.

The Barcode of Life Data Systems (BOLD) is designed to support the generation and application of DNA barcode data. The platform consists of four main modules: a data portal, a database of barcode clusters, an educational portal, and a data collection workbench.

This package retrieves data from the BOLD database of barcode clusters, and allows for searching of over 1.7M public records using multiple search criteria including sequence data, specimen data, specimen plus sequence data, as well as trace files.

Documentation for the BOLD API: http://v4.boldsystems.org/index.php/api_home

See also the taxize book for more options for taxonomic workflows with BOLD: https://taxize.dev/

Installation

Installation instructions

Stable Version

install.packages("bold")

Development Version

Install sangerseqR first (used in function bold::bold_trace() only)

For R < 3.5

source("http://bioconductor.org/biocLite.R")
biocLite("sangerseqR")

For R >= 3.5

if (!requireNamespace("BiocManager", quietly = TRUE))
    install.packages("BiocManager")

BiocManager::install("sangerseqR")

Then install bold

remotes::install_github("ropensci/bold")

Usage

library("bold")

Search for sequence data only

Default is to get a list back

bold_seq(taxon='Coelioxys')[[1]]
#> $id
#> [1] "ABEE117-17"
#> 
#> $name
#> [1] "Coelioxys elongata"
#> 
#> $gene
#> [1] "ABEE117-17"
#> 
#> $sequence
#> [1] "------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTATCATTATATACATATCATCCTTCCCCATCAGTTGATTTAGCAATTTTTTYTTTACATTTATCAGGAATTTYTTYTATTATCGGATCAATAAATTTTATTGTAACAATTTTAATAATAAAAAATTATTCAATAAATTATAATCAAATACCTTTATTTCCATGATCAATTTTAATTACTACAATTTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACAATATTATTATTTGATCGTAATTTAAATTCATCATTTTTTGACCCAATAGGAGGAGGAGATCCTATTTTATATCAACATTTATTTTG------------------------------------"

You can optionally get back the crul response object

res <- bold_seq(taxon='Coelioxys', response=TRUE)
res$response_headers
#> $status
#> [1] "HTTP/2 200 "
#> 
#> $server
#> [1] "nginx"
#> 
#> $date
#> [1] "Mon, 20 Apr 2020 16:11:50 GMT"
#> 
#> $`content-type`
#> [1] "application/x-download"
#> 
#> $`x-powered-by`
#> [1] "PHP/5.3.15"
#> 
#> $`content-disposition`
#> [1] "attachment; filename=fasta.fas"
#> 
#> $`x-frame-options`
#> [1] "SAMEORIGIN"
#> 
#> $`x-content-type-options`
#> [1] "nosniff"
#> 
#> $`x-xss-protection`
#> [1] "1; mode=block"

Search for specimen data only

By default you download tsv format data, which is given back to you as a data.frame

res <- bold_specimens(taxon='Osmia')
head(res[,1:8])
#>      processid   sampleid recordID catalognum   fieldnum
#> 1  BEECA373-06 05-NT-0373   514740            05-NT-0373
#> 2  BEECA607-06 05-NT-0607   516959            05-NT-0607
#> 3  BEECA963-07 01-OR-0790   554153            01-OR-0790
#> 4  BEECB358-07 04-WA-1076   596920 BBSL697174 04-WA-1076
#> 5  BEECB438-07 00-UT-1157   597000 BBSL432653 00-UT-1157
#> 6 BEECC1176-09 02-UT-2849  1060879 BBSL442586 02-UT-2849
#>                    institution_storing collection_code      bin_uri
#> 1   York University, Packer Collection              NA BOLD:AAI2013
#> 2   York University, Packer Collection              NA BOLD:AAC8510
#> 3   York University, Packer Collection              NA BOLD:ABZ3184
#> 4 Utah State University, Logan Bee Lab              NA BOLD:AAC5797
#> 5 Utah State University, Logan Bee Lab              NA BOLD:AAF2159
#> 6   York University, Packer Collection              NA BOLD:AAE5368

Search for specimen plus sequence data

By default you download tsv format data, which is given back to you as a data.frame

res <- bold_seqspec(taxon='Osmia', sepfasta=TRUE)
res$fasta[1:2]
#> $`BEECA373-06`
#> [1] "-ATTTTATATATAATTTTTGCTATATGATCAGGTATAATCGGATCAGCAATAAGAATTATTATTCGTATAGAATTAAGAATTCCTGGTTCATGAATTTCAAATGATCAAACTTATAACTCTTTAGTAACTGCTCATGCTTTTTTAATAATTTTTTTCTTAGTTATACCTTTTTTAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAATCCCGGATATAGCTTTCCCTCGAATAAATAATATTAGATTTTGACTTTTACCCCCTTCATTAATATTATTACTTTTAAGAAATTTTATAAATCCAAGACCAGGTACTGGATGAACTGTTTATCCTCCTCTTTCTTCTCATTTATTTCATTCTTCTCCTTCAGTTGATATAGCCATTTTTTCTTTACATATTTCCGGTTTATCTTCTATTATAGGTTCGTTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAACATATCCAATTACCTTTATTTCCATGATCTGTTTTTATTACTACTATCTTATTACTTTTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCTACAGGAGGTGGAGATCCAATCCTTTATCAACATTTATTT"
#> 
#> $`BEECA607-06`
#> [1] "AATATTATATATAATTTTTGCTTTGTGATCTGGAATAATTGGTTCATCTATAAGAATTATTATTCGTATAGAATTAAGAATTCCTGGTTCATGAATTTCAAATGATCAAGTTTATAATTCATTAGTTACAGCTCATGCTTTTTTAATAATTTTTTTTTTAGTTATACCATTTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAATTCCTGATATAGCTTTTCCTCGAATAAATAATATTAGATTTTGATTATTACCACCATCATTAATACTTTTACTTTTAAGAAATTTTTTTAATCCAAGTTCAGGAACTGGATGAACTGTATATCCTCCTCTTTCATCATATTTATTTCATTCTTCACCTTCTGTTGATTTAGCTATTTTTTCTCTTCATATATCAGGTTTATCTTCTATTATAGGTTCATTAAACTTTATTGTAACTATTATTATAATAAAAAATATTTCTTTAAAGTATATTCAATTGCCATTATTTCCATGATCTGTTTTTATTACTACAATTCTTTTATTATTATCATTACCAGTTTTAGCAGGTGCTATTACTATATTATTATTTGATCGAAATTTTAATACTTCATTTTTTGATCCTACAGGAGGGGGAG--------------------------"

Or you can index to a specific sequence like

res$fasta['GBAH0293-06']
#> $`GBAH0293-06`
#> [1] "------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATGTTAGGGATTCCAGATATAGCTTTTCCACGAATAAATAATATTAGATTTTGACTGTTACCTCCATCTTTAATATTATTACTTTTAAGAAATTTTTTAAATCCAAGTCCTGGAACAGGATGAACAGTTTATCCTCCTTTATCATCAAATTTATTTCATTCTTCTCCTTCAGTTGATTTAGCAATTTTTTCTTTACATATTTCAGGTTTATCTTCTATTATAGGTTCATTAAATTTTATTGTTACAATTATTATAATAAAAAATATTTCTTTAAAATATATTCAATTACCTTTATTTTCTTGATCTGTATTTATTACTACTATTCTTTTATTATTTTCTTTACCTGTATTAGCTGGAGCTATTACTATATTATTATTTGATCGAAATTTTAATACATCTTTTTTTGATCCAACAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTTTACCTGGATTTGGATTAATTTCTCAAATTATTTCTAATGAAAGAGGAAAAAAAGAAACTTTTGGAAATATTGGTATAATTTATGCTATATTAAGAATTGGACTTTTAGGTTTTATTGTT---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------"

Get trace files

This function downloads files to your machine - it does not load them into your R session - but prints out where the files are for your information.

x <- bold_trace(ids = 'ACRJP618-11', progress = FALSE)
read_trace(x$ab1)
#> Number of datapoints: 8877
#> Number of basecalls: 685
#> 
#> Primary Basecalls: NNNNNNNNNNNNNNNNNNGNNNTTGAGCAGGNATAGTAGGANCTTCTCTTAGTCTTATTATTCGAACAGAATTAGGAAATCCAGGATTTTTAATTGGAGATGATCAAATCTACAATACTATTGTTACGGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCCTTATACTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAACAATATAAGTTTTTGGCTTCTTCCCCCTTCACTATTACTTTTAATTTCCAGAAGAATTGTTGAAAATGGAGCTGGAACTGGATGAACAGTTTATCCCCCACTGTCATCTAATATTGCCCATAGAGGTACATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCCTCTATTTTAGGAGCGATTAATTTTATTACTACAATTATTAATATACGAATTAACAGTATAAATTATGATCAAATACCACTATTTGTGTGATCAGTAGGAATTACTGCTTTACTCTTATTACTTTCTCTTCCAGTATTAGCAGGTGCTATCACTATATTATTAACGGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGACNTCNNNNAAGTTTAAN
#> 
#> Secondary Basecalls:

Large data

Sometimes with bold_seq() you request a lot of data, which can cause problems due to BOLD's servers.

An example is the taxonomic name Arthropoda. When you send a request like bold_seq(taxon = "Arthropoda") BOLD attempts to give you back sequences for all records under Arthropoda. This, as you can imagine, is a lot of sequences.

library("taxize")

Using taxize::downstream get children of Arthropoda

x <- downstream("Arthropoda", db = "ncbi", downto = "class")
#> ══  1 queries  ═══════════════
#> ✔  Found:  Arthropoda
#> ══  Results  ═════════════════
#> 
#> ● Total: 1 
#> ● Found: 1 
#> ● Not Found: 0
nms <- x$Arthropoda$childtaxa_name

Optionally, check that the name exists in BOLD's data. Any that are not in BOLD will give back a row of NAs

checks <- bold_tax_name(nms)
# all is good
checks[,1:5]
#>     taxid         taxon tax_rank tax_division parentid
#> 1   26059   Pycnogonida    class     Animalia       20
#> 2      63     Arachnida    class     Animalia       20
#> 3      74   Merostomata    class     Animalia       20
#> 4  493944     Pauropoda    class     Animalia       20
#> 5   80390      Symphyla    class     Animalia       20
#> 6      85     Diplopoda    class     Animalia       20
#> 7      75     Chilopoda    class     Animalia       20
#> 8      82       Insecta    class     Animalia       20
#> 9     372    Collembola    class     Animalia       20
#> 10 734357       Protura    class     Animalia       20
#> 11     84     Remipedia    class     Animalia       20
#> 12     73 Cephalocarida    class     Animalia       20
#> 13     68  Branchiopoda    class     Animalia       20
#> 14 765970   Hexanauplia    class     Animalia       20
#> 15     69  Malacostraca    class     Animalia       20
#> 16 889450 Ichthyostraca    class     Animalia       20
#> 17     NA          <NA>     <NA>         <NA>       NA
#> 18     80     Ostracoda    class     Animalia       20

Then pass those names to bold_seq(). You could pass all names in at once, but we're trying to avoid the large data request problem here, so run each one separately with lapply or a for loop like request.

out <- lapply(nms, bold_seq)

Citation

Get citation information for bold in R by running: citation(package = 'bold')

Meta

  • Please report any issues or bugs
  • License: MIT
  • Get citation information for bold in R doing citation(package = 'bold')
  • Please note that this project is released with a Contributor Code of Conduct. By participating in this project you agree to abide by its terms.

bold's People

Contributors

sckott avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.