Giter Club home page Giter Club logo

genefinder.jl's Introduction


A Gene Finder framework for Julia.

Documentation Release DOI
GitHub Actions License Repo Status Downloads Aqua QA


Overview

This is a species-agnostic, algorithm extensible, sequence-anonymous (genome, metagenomes) gene finder library framework for the Julia Language.

The GeneFinder package aims to be a versatile module that enables the application of different gene finding algorithms to the BioSequence type, by providing a common interface and a flexible data structure to store the predicted ORF or genes. The package is designed to be easily extensible, allowing users to implement their own algorithms and integrate them into the framework.

Warning

This package is currently under development and is not yet ready for production use. The API is subject to change.

Installation

You can install GeneFinder from the julia REPL. Press ] to enter pkg mode, and enter the following command:

add GeneFinder

Finding complete and overlapped ORFs

The main package function is findorfs. Under the hood, the findorfs function is an interface for different gene finding algorithms that can be plugged using the finder keyword argument. By default it uses the NaiveFinder algorithm, which is a simple algorithm that finds all (non-outbounded) ORFs in a DNA sequence (see the NaiveFinder documentation for more details).

Note

The minlen kwarg in the NaiveFinder mehtod has been set to 6nt, so it will catch random ORFs not necesarily genes thus it might consider dna"ATGTGA" -> aa"M*" as a plausible ORF.

Here is an example of how to use the findorfs function with the NaiveFinder algorithm:

using BioSequences, GeneFinder

# > 180195.SAMN03785337.LFLS01000089 -> finds only 1 gene in Prodigal (from Pyrodigal tests)
seq = dna"AACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAACAGCACTGGCAATCTGACTGTGGGCGGTGTTACCAACGGCACTGCTACTACTGGCAACATCGCACTGACCGGTAACAATGCGCTGAGCGGTCCGGTCAATCTGAATGCGTCGAATGGCACGGTGACCTTGAACACGACCGGCAATACCACGCTCGGTAACGTGACGGCACAAGGCAATGTGACGACCAATGTGTCCAACGGCAGTCTGACGGTTACCGGCAATACGACAGGTGCCAACACCAACCTCAGTGCCAGCGGCAACCTGACCGTGGGTAACCAGGGCAATATCAGTACCGCAGGCAATGCAACCCTGACGGCCGGCGACAACCTGACGAGCACTGGCAATCTGACTGTGGGCGGCGTCACCAACGGCACGGCCACCACCGGCAACATCGCGCTGACCGGTAACAATGCACTGGCTGGTCCTGTCAATCTGAACGCGCCGAACGGCACCGTGACCCTGAACACAACCGGCAATACCACGCTGGGTAATGTCACCGCACAAGGCAATGTGACGACTAATGTGTCCAACGGCAGCCTGACAGTCGCTGGCAATACCACAGGTGCCAACACCAACCTGAGTGCCAGCGGCAATCTGACCGTGGGCAACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAGC"

orfs = findorfs(seq, finder=NaiveFinder) # use finder=NaiveCollector as an alternative

12-element Vector{ORF{4, NaiveFinder}}:
 ORF{NaiveFinder}(29:40, '+', 2)
 ORF{NaiveFinder}(137:145, '+', 2)
 ORF{NaiveFinder}(164:184, '+', 2)
 ORF{NaiveFinder}(173:184, '+', 2)
 ORF{NaiveFinder}(236:241, '+', 2)
 ORF{NaiveFinder}(248:268, '+', 2)
 ORF{NaiveFinder}(362:373, '+', 2)
 ORF{NaiveFinder}(470:496, '+', 2)
 ORF{NaiveFinder}(551:574, '+', 2)
 ORF{NaiveFinder}(569:574, '+', 2)
 ORF{NaiveFinder}(581:601, '+', 2)
 ORF{NaiveFinder}(695:706, '+', 2)

The ORF structure displays the location, frame, and strand, but currently does not include the sequence per se. To extract the sequence of an ORF instance, you can use the sequence method directly on it, or you can also broadcast it over the orfs collection using the dot syntax .:

sequence.(orfs)

12-element Vector{LongSubSeq{DNAAlphabet{4}}}:
 ATGCAACCCTGA
 ATGCGCTGA
 ATGCGTCGAATGGCACGGTGA
 ATGGCACGGTGA
 ATGTGA
 ATGTGTCCAACGGCAGTCTGA
 ATGCAACCCTGA
 ATGCACTGGCTGGTCCTGTCAATCTGA
 ATGTCACCGCACAAGGCAATGTGA
 ATGTGA
 ATGTGTCCAACGGCAGCCTGA
 ATGCAACCCTGA

Similarly, you can extract the amino acid sequences of the ORFs using the translate function.

translate.(orfs)

12-element Vector{LongAA}:
 MQP*
 MR*
 MRRMAR*
 MAR*
 M*
 MCPTAV*
 MQP*
 MHWLVLSI*
 MSPHKAM*
 M*
 MCPTAA*
 MQP*

Let's score the ORFs

ORFs sequences can be scored using different schemes that evaluate them under a biological context. The NaiveFinder algorithm provides a simple scheme kwarg that allows scoring the ORFs based on any method that takes a BioSequence as input, returning a score.

A commonly used scoring scheme for ORFs is the log-odds ratio score. This score is based on the likelihood of a sequence belonging to a specific stochastic model, such as coding or non-coding. The BioMarkovChains package provides a log_odds_ratio_score method (currently imported), also known as lors, which can be used to score ORFs using the log-odds ratio approach.

orfs = findorfs(seq, finder=NaiveFinder, scheme=lors)

The score method can be used later to extract the score of the ORFs.

score.(orfs)

12-element Vector{Float64}:
 0.469404606944017
 1.0174520899042823
 1.5914902556997463
 0.9772187907841964
 0.6106494455192994
 0.7089167973379216
 0.469404606944017
 1.5523291911446804
 0.5282685400427601
 0.6106494455192994
 0.7405746713921604
 0.469404606944017

To see more about scoring ORFs, check out the Scoring ORFs section in the documentation.

Writting ORFs into bioinformatic formats

GeneFinder also now facilitates the generation of FASTA, BED, and GFF files directly from the found ORFs. This feature is particularly useful for downstream analysis and visualization of the ORFs. To accomplish this, the package provides the following functions: write_orfs_fna, write_orfs_faa, write_orfs_bed, and write_orfs_gff.

Functionality:

The package provides four distinct functions for writing files in different formats:

Function Description
write_orfs_fna Writes nucleotide sequences in FASTA format.
write_orfs_faa Writes amino acid sequences in FASTA format.
write_orfs_bed Outputs information in BED format.
write_orfs_gff Generates files in GFF format.

All these function support processing BioSequences instances. To demonstrate the use of the write_* methods with a BioSequence, consider the following example:

using BioSequences, GeneFinder

# > 180195.SAMN03785337.LFLS01000089 -> finds only 1 gene in Prodigal (from Pyrodigal tests)
seq = dna"AACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAACAGCACTGGCAATCTGACTGTGGGCGGTGTTACCAACGGCACTGCTACTACTGGCAACATCGCACTGACCGGTAACAATGCGCTGAGCGGTCCGGTCAATCTGAATGCGTCGAATGGCACGGTGACCTTGAACACGACCGGCAATACCACGCTCGGTAACGTGACGGCACAAGGCAATGTGACGACCAATGTGTCCAACGGCAGTCTGACGGTTACCGGCAATACGACAGGTGCCAACACCAACCTCAGTGCCAGCGGCAACCTGACCGTGGGTAACCAGGGCAATATCAGTACCGCAGGCAATGCAACCCTGACGGCCGGCGACAACCTGACGAGCACTGGCAATCTGACTGTGGGCGGCGTCACCAACGGCACGGCCACCACCGGCAACATCGCGCTGACCGGTAACAATGCACTGGCTGGTCCTGTCAATCTGAACGCGCCGAACGGCACCGTGACCCTGAACACAACCGGCAATACCACGCTGGGTAATGTCACCGCACAAGGCAATGTGACGACTAATGTGTCCAACGGCAGCCTGACAGTCGCTGGCAATACCACAGGTGCCAACACCAACCTGAGTGCCAGCGGCAATCTGACCGTGGGCAACCAGGGCAATATCAGTACCGCGGGCAATGCAACCCTGACTGCCGGCGGTAACCTGAGC"

Once a BioSequence object has been created, the write_orfs_fna function proves useful for generating a FASTA file containing the nucleotide sequences of the ORFs. Notably, the write_orfs* methods support either an IOStream or an IOBuffer as an output argument, allowing flexibility in directing the output either to a file or a buffer. In the following example, we demonstrate writing the output directly to a file.

outfile = "LFLS01000089.fna"

open(outfile, "w") do io
    write_orfs_fna(seq, io, finder=NaiveFinder) # use finder=NaiveCollector as an alternative
end
cat LFLS01000089.fna

>seq id=01 start=29 stop=40 strand=+ frame=2 score=0.0
ATGCAACCCTGA
>seq id=02 start=137 stop=145 strand=+ frame=2 score=0.0
ATGCGCTGA
>seq id=03 start=164 stop=184 strand=+ frame=2 score=0.0
ATGCGTCGAATGGCACGGTGA
>seq id=04 start=173 stop=184 strand=+ frame=2 score=0.0
ATGGCACGGTGA
>seq id=05 start=236 stop=241 strand=+ frame=2 score=0.0
ATGTGA
>seq id=06 start=248 stop=268 strand=+ frame=2 score=0.0
ATGTGTCCAACGGCAGTCTGA
>seq id=07 start=362 stop=373 strand=+ frame=2 score=0.0
ATGCAACCCTGA
>seq id=08 start=470 stop=496 strand=+ frame=2 score=0.0
ATGCACTGGCTGGTCCTGTCAATCTGA
>seq id=09 start=551 stop=574 strand=+ frame=2 score=0.0
ATGTCACCGCACAAGGCAATGTGA
>seq id=10 start=569 stop=574 strand=+ frame=2 score=0.0
ATGTGA
>seq id=11 start=581 stop=601 strand=+ frame=2 score=0.0
ATGTGTCCAACGGCAGCCTGA
>seq id=12 start=695 stop=706 strand=+ frame=2 score=0.0
ATGCAACCCTGA

This could also be done to writting a FASTA file with the nucleotide sequences of the ORFs using the write_orfs_fna function. Similarly for the BED and GFF files using the write_orfs_bed and write_orfs_gff functions respectively.

genefinder.jl's People

Contributors

camilogarciabotero avatar dependabot[bot] avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar

Forkers

vdejager

genefinder.jl's Issues

Reconsider start and stop in the IO methods

The ORF struct is normally defined with a location field that is of type UnitRange{Int64}. This has been used with the default step (i.e., 1) argument. So even if the strand field of ORF is - the start will always be determined by the "positive" strand range.

This is not an issue for the get_orfs_* methods since they use the following treatment:

Base.getindex(sequence::NucleicSeqOrView{A}, orf::ORF) where {A} = orf.strand == '+' ? (@view sequence[orf.location]) : reverse_complement(@view sequence[orf.location])

The inverted range is, for instance, how negative stranded ORF are displayed in PHANOTATE outputs (c.f source code).

The things to reconsider are:

  • Are the other ORF applications using this convention as well?
  • Would revamping this bring some benefits to the performance?
  • The write methods should at least advertise this. However, judging by the previous test with IGV it is found to have only positive ranges at start and stop.

TagBot trigger issue

This issue is used to trigger TagBot; feel free to unsubscribe.

If you haven't already, you should update your TagBot.yml to include issue comment triggers.
Please see this post on Discourse for instructions and more details.

If you'd like for me to do this for you, comment TagBot fix on this issue.
I'll open a PR within a few hours, please be patient!

The `iscoding` should be more generic.

Since we want to apply this predicate to any sequence eventually, the way in which different algortihms/implementations consider that a sequence is probably encoding information varies. Some, as the current naivefinder considers models, then it will use that input information. Now, to be more generic the general iscoding (currently changed to isnaivecoding should be something like:

function iscoding(sequence::LongSeqOrView{DNAAlphabet{N}}, method::Function; kwargs...) where {N}
    ...
end

Using score to filter what `getorfs` delivers

After #26 and #32 we can now have a more flexible way to use the findorfs with multiple ORF finder methods with or without scoring scheme. Now, we can levearege on that to make getorfs more complex by adding a scoring filter to get only the sequences that actually are above a scoring threshold. For instance the argmax to the orf.score field will help.

orfs[argmax([orf.score for orf in orfs])]

We can also use a combination of sorting and filtering:

sortedorfs = sort(orfs, by = orf -> -orf.score)
sortedorfs[1:min(10, end)]

The function will gain a min_score kwarg:

function getorfs(
    sequence::NucleicSeqOrView{DNAAlphabet{N}},
    ::DNAAlphabet{N},
    method::M;
    kwargs...
    min_score=0
) where {N,M<:GeneFinderMethod}
 ...
end

Still to define...

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.