Comments (11)
Hi @francicco,
For Tigmint, the barcodes are expected to be in the BX:Z:
tag of the read headers - in the format that longranger basic
produces. If you want to use the tigmint-make
Makefile, the reads also need to be in a single, interleaved file (again, the default output from longranger basic
) - I recommend running the pipeline using the Makefile vs. running each command separately, which can be a bit more error-prone. Just FYI - ARCS can also now also use the barcode information from the BX:Z:
tags of the read alignments -- take a look at the arcs-make
Makefile for more details, or feel free to ask follow-up questions in that repository.
As for the error that you're seeing -- what version of python are you using? What version of tigmint are you using?
Lauren
from tigmint.
My version of Python is the 2.7.5
. The version of tigmint is the latest I guess, I cloned it saturday. This is the way I can convert barcoded_unaligned.bam read.
Is that correct?
@A00618:19:HHCTMDMXX:2:1351:5520:13401/1 RX:Z:AAAAAAAAAAAAAGGA
AGAGTGGGTAAGATTTATTTTTAAAAAGTATTTATATAGTTTTTGTGAGAAATTTTTTAGTAGTTTTTAGGTTTGGGATGAGATGAGTGAAGATGAGAAGAATAGGATAATATTTAGGTATATAAGA
+
FFFF,FFFF,FF:FFF:FFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFF:FFFF:FFFFFFFFFFFFFF,,F,FF:::FFFFFFF,FFFFF::F:FFFFFFFFF,F,F:FF,FFFFF:F
Thanks
F
from tigmint.
Hi @francicco,
Tigmint requires python3
- so try making sure a python3+ version is on your path (with the required modules installed).
As for the reads, do you have the output from longranger basic
still? If so, using that interleaved file would be the easiest for you. If not, the barcode needs to be in a BX:Z:
tag of the read header (not RX:Z:
tag):
Ex:
@E00247:267:HMVT3CCXX:1:1120:14945:59200 BX:Z:AAACACCAGACAATAC-1
CAAGGCATTCTGGGCTCAGGCATTCTTGTGGTAGGCATTCTACCACAAGGCATTCTGGGCTCAGGCATTCTTGTGGTAGGCATGCTGCCACAAGGCATTCAGGACTCAGGCATTCTTGTGGTAGGTAG
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK7A<<AFFKA,77<F<KF<F<7<,7<F7,,,AK<K7KK<A,AF,AFA,FF,A<,7,,,,,7A<A,,,,,,,A,,,<AFAFAFKAFAKA,,<7A,,
@E00247:267:HMVT3CCXX:1:1120:14945:59200 BX:Z:AAACACCAGACAATAC-1
ACCACAAGAATGCCTGAGCCCAGAATGCCTTGTGGTAGAATGTCTACCAGAAGATAGATTGGGAGAACGACGCGTTGGGGTAGAGTGTAGACCGCGGTGATCGCCGGATCATGAACGAATTGGGGTAGAGTGTAGACCGGGGTGGTCGGCG
+
AAAFFKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK<KA,7,7F<,,,,,,,,A,,,A,,,,,,,,,,A(,F,A,A,,AKKFKKK,,<,7,,(77,,A,AAAA((,,,,,,A,,,,,,,,AA,AFKFF7,,,,,,,((,,<(,,,(,<
Hope that helps!
Lauren
from tigmint.
From longranger basic
I get the bam. Is there a quick way to covert it into a fastq?
Thanks
D
from tigmint.
What about the number at the end of the barcode? BX:Z:AAACACCAGACAATAC-1
I don't have it
F
from tigmint.
Oh I see -- So you used the --bam
option with longranger basic
then? We output a fastq
file here.
Do you have abyss
installed? You can use abyss-tofastq --bx
to convert the BAM to a fastq file with the BX tags in the header if so. Otherwise I think that samtools fastq -TBX
should work as well.
The number at the end of the barcode is the 'read group'. It can be used to distinguish different chromium libraries.
from tigmint.
from tigmint.
Hi @francicco,
Sounds good! Interesting that you don't have both the RX
and BX
tags -- one is the raw barcode, while the other is the processed (corrected) barcode, and the few chromium BAMs I've looked through do have both of those.
This page lists all the tags you should be seeing: https://support.10xgenomics.com/genome-exome/software/pipelines/latest/output/bam
It is recommended that you use the BX
tag (which has error correction and was checked against the barcode white list) for your analysis.
As for the number, yes you are OK without the read group number if you only have one library.
Glad I can help!
Lauren
from tigmint.
Hi Lauren,
using tigmint-make
I get this error at the end of the alignment
gzclose] buffer error
[bam_sort_core] merging from 32 files and 32 in-memory blocks...
make: *** [draft.reads.sortbx.bam] Error 1
make: *** Deleting file `draft.reads.sortbx.bam'
Now I'm trying running each command separately.
F
from tigmint.
Ok, works!!!
from tigmint.
Glad you got it working!
from tigmint.
Related Issues (20)
- About samtools invalid option in tigmint-make arcs mode HOT 4
- pre-alignment HOT 2
- Forward+reverse + long reads HOT 4
- yet another "make: *** No rule to make target" issue HOT 5
- Feature has length = 0, Skipping - followed by empty output from tigmint-long HOT 9
- Understanding tigmint-long outputs HOT 3
- tigmint compilation issue HOT 2
- _sqlite3.cpython-310-x86_64-linux-gnu.so: undefined symbol: sqlite3_trace_v2
- Error : no progress of scaffolding running HOT 5
- tigmint-long error HOT 1
- Respect $TMPDIR as anticipated by sort tool HOT 1
- samtools sort may be replaced by bamsort which scales better HOT 2
- pigz may be better replaced by bgzip HOT 2
- tigmint-make ignores $PATH and is supposed to be run from unpacked source tree instead HOT 3
- README does not list all dependencies HOT 2
- Does bin/tigmint_estimate_dist.py really work with FASTA files as well? HOT 5
- src/long-to-linked-pe v1.0: Using more than 6 threads does not scale, reverting to 6. HOT 5
- tigmint_molecule_paf.py: TypeError: expected string or bytes-like object HOT 11
- Cannot compile the bundled while modified copy of make: make-4.1/glob/glob.c:1342: undefined reference to `__alloca' HOT 6
- tigmint-make: minimap2 is being called with -y argument HOT 3
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from tigmint.