AMGT-TS(Accurate Microsatellite Genotyping Tool based on Targeted Sequencing) is an accurate tool for large-scale microsatellite genotyping tool for targeted sequencing data.

Copyright Holder: Wang Fengge, Huo Yongxue
email: [email protected]

For a quick start purpose instead of diving into the details, we recommend to visit the online version instead: https://amgt-ts.plantdna.site:8445/. It is a pre-installed version, and wrapped with web pages interface. Hope that will bring you a better experience.

Running AMGT-TS requires a GNU-like environment. It should be possible to run AMGT-TS on a Linux or Mac OS, Ubuntu Server 18.04 is recommended.

AMGT-TS requires the following external tools:

1. bamtools　(2.5.0)
2. blast tool suite (2.6.0+)
3. bwa　(0.7.17-r1188)
4. fastx_toolkit (0.0.13)
5. picard　(2.15.0-SNAPSHOT)
6. samtools (1.3.1)
7. seqtk (1.2)

Seven tools maybe the seven demigods in the book "The Heroes of Olympus" by Rick Riordan.

Please config the tools in the profile first. An example is the file under subtools named profiles-maizedna-1.sh

./amgt-ts.sh SCRIPT_DIR ENV_FILE METHOD

Here amgt-ts.sh takes 3 parmeters:

1. SCRIPT_DIR: the folder which the amgt-ts.sh located

2. ENV_FILE: the configuration file

3. METHOD: to specify the algorithm: precise or broad

   You can add -p or --project to specify a project name, for multi-project supporting purpose. Please check the launch.sh to find the usage details.

• Format of reference fasta file

  It is a standard fasta file, which holds the locus name and sequence information.

• Format of reference stat information:

#ID	SSR.No	Motif_len	Motif	Repeat_times	Start	End	Repeat_len	Seq_len
s258878	1	3	GCT	5	301	315	15	615
s282049	1	3	TGG	5	301	315	15	615
s282991	1	3	TGT	5	301	315	15	615

This file show the detail information of the references.

• Output files

1. Variants for all loci of each sample working/04_reads/SAMPLE_NAME.site.stat

#Site   Motif   Repeat_len      Reads_num       Total_reads     Proportion
s258878 GCT     3       16      2350    0.0068085106383
s258878 GCT     6       1085    2350    0.46170212766
s258878 GCT     9       1249    2350    0.531489361702

This file shows result of all variants for each locus of a sample.

2. Variants for each locus of each sample working/04_reads/SAMPLE_NAME/LOCUS_NAME/LOCUS_NAME.ssr.stat

#Site   Motif   Repeat_len      Reads_num       Total_reads     Proportion
s258878 GCT     3       16      2350    0.0068085106383
s258878 GCT     6       1085    2350    0.46170212766
s258878 GCT     9       1249    2350    0.531489361702

3. Reads for each variants of each locus of each sample working/04_reads/SAMPLE_NAME/LOCUS_NAME/SSRn.fas Standard fasta file, grouped all reads corresponding a variants of a locus of a sample.

example as:

>CRC8E:03524:00917
GATCTGTTTGCCAGCTGGGGCAAGATTTCTTCGGTGCCTGCACCCTTTCTCTTGCGGTTGTTTATGCTATCGCTGCTGCTGATTGTGGGGTTCCTGCGTTCGCCACTGTGACTGTCACTTTGCTGGTGCTGTTCCTGGTTGCATCTGCTTTTCAGTATGTGGGGCTTGAGCTTGTTC
>CRC8E:03306:03509
TAACTGTGCCTTGATCTGTTTGCCAGCTGGGGCAAGATTTCTTCGGTGCCTGCACCCTTTCTCTTGCGGTTGTTTATGCTATCGCTGCTGCTGATTGTGGGGTTCCTGCGTTCGCCACTGTGACTGTCACTTTGCTGGTGCTGTTCCTGGTTGCATCTGCTTTTCAGTATGTGGGGCTTGAGCTTGTTC
>CRC8E:04520:05520
GATCTGTTTGCCAGCTGGGGCAAGATTTCTTCGGTGCCTGCACCCTTTCTCTTGCGGTTGTTTATGCTATCGCTGCTGCTGATTGTGGGGTTCCTGCGTTCGCCACTGTGACTGTCACTTTGCTGGTGCTGTTCCTGGTTGCATCTGCTTTTCAGTATGTGGGGCTTGAGCTTGTTC