Giter Club home page Giter Club logo

Andres Smiith's Projects

omr icon omr

Optical Mark Recognition with PHP

platzimusic icon platzimusic

Proyecto para el Curso de Introducción a Vue.js de Platzi

portal_web icon portal_web

Proyecto realizado como ejercicio para el modulo número 7 del curso de "Desarrollo web desde cero paso a paso" en el sitio web de udemy.

quiz icon quiz

Proyecto creado por el curso "Desarrollo de servicios en la nube con HTML5, Javascript y node.js" en la pagina https://miriadax.net

repeateddnasequences icon repeateddnasequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T. In research, it can be useful to identify repeated sequences within DNA. Write a function to find all the 10-letter sequences (substrings) that occur more than once in a DNA molecule s, and return them in lexicographical order. These sequences can overlap. Example For s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", the output should be repeatedDNASequences(s) = ["AAAAACCCCC", "CCCCCAAAAA"]. Input/Output [execution time limit] 4 seconds (php) [input] string s Guaranteed constraints: 0 ≤ s.length ≤ 5000. [output] array.string An array containing all of the potential 10-letter sequences that occur more than once in s.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.