smiithx Goto Github PK
Name: Andres Smiith
Type: User
Company: Desweb
Twitter: Andres_smiith
Location: Colombia
Blog: desweb.tech
Name: Andres Smiith
Type: User
Company: Desweb
Twitter: Andres_smiith
Location: Colombia
Blog: desweb.tech
Course of Hibernate y Java Spring in platzi.com
Curso de wordpress
Optical Mark Recognition with PHP
Collection of platzi scripts for classes
Aplicación desarrollada en https://platzi.com/cursos/react-native/
Proyecto para el Curso de Introducción a Vue.js de Platzi
Proyecto realizado como ejercicio para el modulo número 7 del curso de "Desarrollo web desde cero paso a paso" en el sitio web de udemy.
Proyecto creado por el curso "Desarrollo de servicios en la nube con HTML5, Javascript y node.js" en la pagina https://miriadax.net
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T. In research, it can be useful to identify repeated sequences within DNA. Write a function to find all the 10-letter sequences (substrings) that occur more than once in a DNA molecule s, and return them in lexicographical order. These sequences can overlap. Example For s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", the output should be repeatedDNASequences(s) = ["AAAAACCCCC", "CCCCCAAAAA"]. Input/Output [execution time limit] 4 seconds (php) [input] string s Guaranteed constraints: 0 ≤ s.length ≤ 5000. [output] array.string An array containing all of the potential 10-letter sequences that occur more than once in s.
Creando tienda virtual
A declarative, efficient, and flexible JavaScript library for building user interfaces.
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google ❤️ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.