Comments (9)
need to attach some data or else i can't debug/fix this. when i try to
simulate the issue, everything works fine.
Original comment by [email protected]
on 3 Sep 2014 at 8:53
from ea-utils.
(probably like 10 or so reads + adatpors.fa you are using)
Original comment by [email protected]
on 3 Sep 2014 at 8:53
from ea-utils.
Here's what I just tried on Ubuntu 14.04 ... worked fine. So it's not a
trivial case.
Scale used: 2.2
Phred: 64
Threshold used: 1 out of 4
Adapter 3p_for_test (CATGATTGATGGTGCCTACAG): counted 4 at the 'start' of
'test5.fq', clip set to 1
Files: 1
---cut---
@1
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAT
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@2
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@3
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@4
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAC
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
Original comment by [email protected]
on 3 Sep 2014 at 9:18
from ea-utils.
also, i fixed the makefile so you don't need to make sparsehash first
Original comment by [email protected]
on 3 Sep 2014 at 9:19
from ea-utils.
Apologies - please find attached the adaptors.fa and the first 10 reads of the
fastq file that I am using. I verified that I am still seeing the same problem
with the cut down file.
If you want to play with the whole file, it is available in the NCBI sequence
read archive - the accession number is the file name.
I have seen this problem with every file I have tried, including test examples
similar to yours above so I am wondering if it is something screwy with my
installation of 14.04 - I can't think what though as it is a standard
installation and up to date, and I didn't see any unusual warnings or anything
when compiling on 14.04. If it makes any difference, all the installations of
Ubuntu I am testing here have 64-bit architecture.
Original comment by [email protected]
on 4 Sep 2014 at 9:16
Attachments:
from ea-utils.
ok! i can reproduce this on a 64-bit virtualbox... i had to update my bios,
enable hardware acceleration, and update the number of cores to get it to
break. i added a new test for it, which nicely passes under other
versions/instances of ubuntu
Original comment by [email protected]
on 4 Sep 2014 at 3:09
from ea-utils.
Ha ha! Yes, the 14.04 machine is less than a year old, and has 8 cores. Maybe
I should just trim on my laptop instead! Glad you have reproduced the problem -
I was beginning to think that I was just doing something stupid :-)
Original comment by [email protected]
on 4 Sep 2014 at 3:21
from ea-utils.
This has been fixed. I deprecated the 780 release, and added a new release
806, which has a) the fix and b) the test for the fix.
Original comment by [email protected]
on 4 Sep 2014 at 3:47
- Changed state: Fixed
from ea-utils.
Great, thanks!
Original comment by [email protected]
on 4 Sep 2014 at 4:06
from ea-utils.
Related Issues (20)
- sam-stats doesn't support -o and -O option HOT 3
- Incorrect total reads when using FIFO HOT 2
- fastq-mcf: invalid adapter file ==> Floating point exception HOT 1
- The gtf2bed script generate bed with wrong chrStart and chrEnd coordinates for plus strand HOT 4
- Limit on the number of files it can handle HOT 1
- fastq-multx when barcode is in header between # and / symbols? HOT 7
- fastq-multx supporting sequence in header HOT 1
- Compilation on Mac HOT 2
- Giant FASTQ support in stats HOT 3
- Wrong number (/ counter / calculation) in summary statistics of fastq-mcf HOT 2
- error message: "fastq-mcf has stopped working" HOT 4
- gtf2bed wrong output. HOT 1
- compilation error because sparsehash/sparse_hash_map is not found HOT 1
- "fastq-mcf has stopped working"
- Patches for porting ea-utils to other POSIX platforms + warnings clean-up HOT 1
- Use fastq-mcf with methylation data HOT 2
- installing ea-utils on windows7 HOT 1
- gsl_randist.h: No such file or directory HOT 1
- Support for detecting fixed-length prefix barcodes for fastq-multx
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from ea-utils.