fastq-mcf not working correctly on ubuntu 14.04 about ea-utils HOT 9 CLOSED

need to attach some data or else i can't debug/fix this.  when i try to 
simulate the issue, everything works fine.

(probably like 10 or so reads + adatpors.fa you are using)

Here's what I just tried on Ubuntu 14.04 ... worked fine.   So it's not a 
trivial case.

Scale used: 2.2
Phred: 64
Threshold used: 1 out of 4
Adapter 3p_for_test (CATGATTGATGGTGCCTACAG): counted 4 at the 'start' of 
'test5.fq', clip set to 1
Files: 1

---cut---
@1
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAT
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@2
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@3
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAG
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
@4
CATGATTGATGGTGCCTACAGATCAGCTAGGCATCGATATATCGATCGGCTAGAGATATACGATCGAC
+
hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

also, i fixed the makefile so you don't need to make sparsehash first

Apologies - please find attached the adaptors.fa and the first 10 reads of the 
fastq file that I am using.  I verified that I am still seeing the same problem 
with the cut down file.

If you want to play with the whole file, it is available in the NCBI sequence 
read archive - the accession number is the file name.

I have seen this problem with every file I have tried, including test examples 
similar to yours above so I am wondering if it is something screwy with my 
installation of 14.04 - I can't think what though as it is a standard 
installation and up to date, and I didn't see any unusual warnings or anything 
when compiling on 14.04.  If it makes any difference, all the installations of 
Ubuntu I am testing here have 64-bit architecture.

ok! i can reproduce this on a 64-bit virtualbox... i had to update my bios, 
enable hardware acceleration, and update the number of cores to get it to 
break.   i added a new test for it, which nicely passes under other 
versions/instances of ubuntu

Ha ha!  Yes, the 14.04 machine is less than a year old, and has 8 cores.  Maybe 
I should just trim on my laptop instead! Glad you have reproduced the problem - 
I was beginning to think that I was just doing something stupid :-)

This has been fixed.   I deprecated the 780 release, and added a new release 
806, which has a) the fix and b) the test for the fix.

Great, thanks!