mdshw5 / fastqp Goto Github PK

Maybe look at either regression coefficient or residuals to flag abnormal positional kmers.

Two cases:

1. Unguided null distribution where expected frequency is computed using draws from a uniform distribution of ACTG
2. Transcriptome-guided null distribution where a 1) GTF and 2) fasta file are provided and sequences are sampled from exons and UTRs.

cc: @jmerkin

A fast strategy would be to break adapter sequences into kmers, and then classify previously counted kmers into "possible adapter" kmers.

I'd like to test importing across multiple experiments into Spotfire for visualization. This should just involve concatenation of multiple results tables.

Hi all,

With matplotlib 2.1.0 I get MatplotlibDeprecationWarning: The set_axis_bgcolor function was deprecated in version 2.0. Use set_facecolor instead.. With the latest matplotlib-2.2.2 it now raises an exception.

Is there a recommended matplotlib version?

Hello @mdshw5 @ucpete @danielecook @tomsherborne @edawine , I am using python.2.7.12 and the following OS

CentOS release 6.5 (Final)
Cluster Manager v7.0
slave
LSB_VERSION=base-4.0-amd64:base-4.0-noarch:core-4.0-amd64:core-4.0-noarch:graphics-4.0-amd64:graphics-4.0-noarch:printing-4.0-amd64:printing-4.0-noarch
CentOS release 6.5 (Final)
CentOS release 6.5 (Final)

I am getting the error

657,845,172 reads in input file.
Bin size (-s) set to 328.
Traceback (most recent call last):
  File "/cm/shared/apps/python/2.7.12/bin/fastqp", line 10, in <module>
    sys.exit(main())
  File "/cm/shared/apps/python/2.7.12/lib/python2.7/site-packages/fastqp/cli.py", line 412, in main
    run(arguments)
  File "/cm/shared/apps/python/2.7.12/lib/python2.7/site-packages/fastqp/cli.py", line 352, in run
    mismatchplot(positions, cycle_mismatch, zip_archive, fig_kw)
  File "/cm/shared/apps/python/2.7.12/lib/python2.7/site-packages/fastqp/plots.py", line 659, in mismatchplot
    for pos in positions
ZeroDivisionError: division by zero 

I checked the issues board, specifically the closed #26

(#26)

which had a "hack-ish" solution #28 . In the source code (current version) the plots.py does not contain the lines mentioned

(3648187)

. Please advise!

Some recent BS-seq programs store methylation information in a SAM tag. One example is Bismark. A flag for --methylation would activate routines for summarizing:

• Cycle-specific CpG cytosine methylation
• Cycle-specific cytosine conversion
• Methyl-C content percent per read

Multiple input files should be handled as a batch where one file corresponds to one set of figures and data tables.

Dear, I just install fastqp and an error occurred when i run the script, this is the error.

fastqp Sanger_F_sample.fastq
At 2186 bytes per read of 1086 length we estimate 96 reads in input file.
Bin size (-s) set to 1.
Traceback (most recent call last):
File "/usr/local/bin/fastqp", line 11, in
sys.exit(main())
File "/usr/local/lib/python2.7/site-packages/fastqp/cli.py", line 370, in main
run(arguments)
File "/usr/local/lib/python2.7/site-packages/fastqp/cli.py", line 270, in run
cycle_nuc[i]['T']]) * 100 for i in positions]
ZeroDivisionError: integer division or modulo by zero

Any idea why this error occurred?
I use OSx, python 2.7.13 and a sample of the fastq file is on the attachment.

Regards
Sanger_F.fastq.zip

This is something FastQC does automatically.

Running fastqp input.bam -o output -d raises UnboundLocalError: local variable 'ScalableBloomFilter' referenced before assignment

The bug can be traced to cli.py lines 132-133 and 138-139. The order of two blocks need to be reversed (or better, the two blocks need to be merged since they are testing for the same thing), so that ScalableBloomFilter is imported before it's used.

Cycler replaces the older axes.color_cycle in matplotlib >= 1.5

I'm trying to generate a plot of fastq quality along a very long (800kb) assembly sequence. When I run fastqp I get the following and seemingly no non-stdout output:

At 1775681 bytes per read of 887828 length we estimate 1 reads in input file.
Bin size (-s) set to 1.

It might be the case that this is simply not the appropriate tool. The goal is simply a summary of support of given nucleotide calls along the de novo reference. All advice is much appreciated!

I see that the info is output in an unstructured way on the stout, but for those of us that would like to do some other types of viz, it would be nice to have the raw data.

Thanks, Matt

Hi!

We are doing riboseq analysis on some fastq files. We are using Fastp for adapter identification and removal. But, we are facing some problems. fastp is able to remove the adapter sequences only if the adapter seq is given in the command line as an argument. It is not able to detect the adapter and remove it by itself and is giving the output as adapter is not detected. The sra file used, adapter seq and codes are as follows:

SRA file : SRR810103 (fastq size 31.6GB)

adapter seq: TCGTATGCCGTCTTCTGCTTG

./fastp -i ./SRR810103.fastq -a TCGTATGCCGTCTTCTGCTTG -q 33 -w 10 -o./output.fastq

./fastp -i ./SRR810103.fastq -w 10 -o ./output.fastq

Can you please help us?

Eagerly waiting for your help!

It seems like most plots could be generated using plotly which will let me focus on performance and correctness.

See #20

https://github.com/ewels/MultiQC

• What test FASTQ files should I run with?
• Need to submit log files from test run to https://github.com/ewels/MultiQC_TestData

From @ewels:

If you're requesting a new module

Checklist of requirements:

• Description of tool, link to homepage
• Log files - please submit as a PR to https://github.com/ewels/MultiQC_TestData
• Any standard log file naming patterns to get sample name (eg. sample_name.processed.log)
• Say which value is most important, to go into the General Stats table
• Specify what should be plotted, if anything