Giter Club home page Giter Club logo

Comments (5)

lh3 avatar lh3 commented on August 22, 2024

At least for human, (TTAGGG)n only occurs at the 3'-end of a chromosome. I assume Chr1_chal_sis is very long and you are only showing part of the sequence. If this is the case, seqtk telo wouldn't consider (TTATTGGG)n as part of a telomere because it is on the 5'-end.

from seqtk.

lh3 avatar lh3 commented on August 22, 2024

Just checked the paper. They were using short reads. The inverted motif could be an assembly artifact. It would be more convincing if we have HiFi reads.

from seqtk.

jbh-cas avatar jbh-cas commented on August 22, 2024

We do have a HiFi assembly made with hifiasm using PacBio long reads. And, as you say, the test text was a very truncated view of the Chr, thanks for pointing out the folly of using it as a reliable test.

I found the 8mer from the short read paper but confirmed its existence in our HiFi assembly using grep for the 8mer.
I'll go back to that and get additional info.

Thank you.

from seqtk.

lh3 avatar lh3 commented on August 22, 2024

its existence in our HiFi assembly using grep for the 8mer.

Where are TTATTGGG 8-mers? Are they located on the 3'-ends of contigs, or following (CCCAATAA)n on the 5'-end like the example you have shown?

from seqtk.

jbh-cas avatar jbh-cas commented on August 22, 2024

At the bottom or very near bottom.

I made a 8Mbp test file named tst2 with the CCCAATAA at top TTATTGGG at bottom and revcomp version tst2_rc to flip them and these were the results:

$ seqtk telo -m CCCAATAA tst2
Chr1r_chal_sis	0	960	8403000
960	8403000
$ seqtk telo -m CCCAATAA tst2_rc
Chr1r_chal_sis	8402040	8403000	8403000
960	8403000
$ seqtk telo -m TTATTGGG tst2
0	8403000
$ seqtk telo -m TTATTGGG tst2_rc
0	8403000

$ grep TTATTGGG tst2_rc -n 
70019:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70020:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70021:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70022:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70023:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70024:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70025:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG
70026:GGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTGGGTTATTG

I used seqtk to fold at 120 chars for the file, so first TTATTGGG hit is at 8,402,280 bases in.

I'm sure you have more important things, I just thought having tried in this non-standard case that I would pass it along. I can always use a squishy regex with grep to find as I have been doing with the vertebrate 6mer.

As an aside, I do hope that telomere awareness can be used in assemblers and scaffolders as an option. We run a telomere script after every assembly or use of yahs and show the records and their telos as TOP, TOP_NEAR, BOTTOM, BOTTOM_NEAR or MIDDLE.

Thanks for taking the time.

from seqtk.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.