Giter Club home page Giter Club logo

Comments (3)

AlsoATraveler avatar AlsoATraveler commented on August 16, 2024

The same is A*01:01:02, and TGGAGAACGGGAAGGAGACGCTGCAGCGCACGGA, which is TGGAGAACGGGAAGGAGACGCTGCAGCGCACGGG in A_gen.fasta

from imgthla.

dominicbarkerAN avatar dominicbarkerAN commented on August 16, 2024

Hello, I have reviewed the sequence you have suggested and found no issue with it. The sequence in 3.40.0 is the same as the sequence in the latest release, which is correct. The issue that you are having is that you are not correctly splitting the CDS sequence in the A_nuc.fasta file into exons to search for it in the A_gen.fasta, which contains exons and introns.

For example you say that the A_nuc.fasta file ends AAAGTGTGA which does not appear in the A_gen.fasta. That is because this sequence you are searching for covers two exons, the end of exon 7 and exon 8. It would not appear in the A_gen.fasta because of the intron 7 sequence between these two. The exon 7 and exon 8 sequence of A*01:01:02 is:

exon 7: GCAGTGACAGTGCCCAGGGCTCTGATGTGTCTCTCACAGCTTGTAAAG
exon 8: TGTGA

The same is true for your second comment which contains sequence crossing exon 3 and 4.

from imgthla.

AlsoATraveler avatar AlsoATraveler commented on August 16, 2024

Oh, thanks.

from imgthla.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.