Giter Club home page Giter Club logo

Comments (4)

 avatar commented on July 17, 2024

Can you please confirm the alleles and branch the files are found in. The latest release has two alleles matching DPB101:01:01 (DPB101:01:01:01 and DPB1*01:01:01:02) and the alignment file is now named DPB1_nuc.txt. Reviewing these files the DPB1_nuc.txt and DPB1_nuc.fasta appear consistent for these alleles.

from imgthla.

rleonid avatar rleonid commented on July 17, 2024

My apologies, I meant allele DPB1*13:01:02. I erred in my copy-and-pasting. Yes, I'm using DPB1*01:01:01:01 as the reference allele. The difference is between the DPB1_nuc.txt or DPB1_nuc.fasta files.

For example, the last part of the alignment file for the reference and the allele:

$ grep -E "DPB1*01:01:01:01|DPB1*13:01:02" alignments/DPB1_nuc.txt | tail -n 2
DPB101:01:01:01 AAG AAA G|TT CAA CGA GGA TCT GCA TAA
DPB1
13:01:02 --- --- -|-- --- --- --- --- --- --*

Sorry, but the font sizes won't line up. The last line of DPB1*13:01:02's fasta entry:

$ gawk 'BEGIN { RS=">" }; /DPB1*13:01:02/{printf RS; printf $0}' fasta/DPB1_nuc.fasta | tail -n 1
GGAGTGGGCATCTTCATGCACAGGAGGAGCAAGAAAGTTCAACGAGGATCTGCATAA

from imgthla.

 avatar commented on July 17, 2024

We are currently looking to see if this discrepancy is in any of the other formats. Once this is compete, we will look at applying an update to the necessary files.

from imgthla.

jrob119 avatar jrob119 commented on July 17, 2024

This should be addressed in the latest release (3.31.0)

from imgthla.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.