abatelab / sic-seq Goto Github PK

Hi @bdemaree,

I am really excited about this method and I hope to incorporate it into my own research. I am trying to recreate your work so I can see whether my aims are doable, but I'm having trouble getting past the first step! Whenever I attempt to run the barcode cleanup script, I get this message - 'barcodeCleanup.py: error: too few arguments.' Thank you for any help!

python2 SiC-seq_repository/barcodeCleanup.py --SE \
-R1 10_cell_sicseq_R1.fastq.gz \
-RI 10_cell_sicseq_RI.fastq.gz \
-align Y \
-bt2 ZymoBIOMICS_std_bowtie2_index/ZymoBIOMICS_std_ref

Hi @bdemaree

I was hoping you could help me solve this error. The kraken database I used only comprises only Alteromonas genomes, and the sqlite database only contains SRR5208456. Thank you for any help!

command used:

python2 kraken.py --SE \
sicseq_456-ACE-50barCutoff.db 

Error:

Creating table for Kraken data...
Table kraken set up successfully.
6561396 sequences (836.53 Mbp) processed in 34.970s (11257.8 Kseq/m, 1435.28 Mbp/m).
42099 sequences classified (0.64%)
6519297 sequences unclassified (99.36%)
Traceback (most recent call last):
File "kraken.py", line 289, in
kraken() # Run Kraken and insert data into sqlite db
File "kraken.py", line 218, in kraken
(tableK, domain, phylum, Class, order, family, genus, species, barcode, barID))
sqlite3.OperationalError: no such table: kraken

Hi Ben,

This is Jessie Ren, a PhD student from USC. I was very excited when I read the SiC-seq paper. Congratulations!

I am interested in analyzing the single-cell samples in your paper. I am wondering where the 15 bp barcode locates in each read. Based on my understanding from the paper (Figure 2e), the barcode should be the sequence flanked by the constant sequence1="AAGCCAGCCCCGACACT" and constant sequence2="GCAGCTGGCGTAATAGCGAGTACAATCTGCTCTGATGCCGCATAG". If it is the case, I should first look for the two constant sequences in the reads. The barcode will be the sequence in between. Then the bacterial sequence is after the constant sequence2. Is my understanding correct?

In addition, have the adaptors and primers been trimmed from the reads?

Thank you very much for your help.

Best wishes,
Jessie